|
US$169.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
GB/T 25876-2010: Method of nested PCR for sex identification of early cattle embryo
Status: Valid
| Standard ID | Contents [version] | USD | STEP2 | [PDF] delivered in | Standard Title (Description) | Status | PDF |
| GB/T 25876-2010 | English | 169 |
Add to Cart
|
3 days [Need to translate]
|
Method of nested PCR for sex identification of early cattle embryo
| Valid |
GB/T 25876-2010
|
PDF similar to GB/T 25876-2010
Basic data | Standard ID | GB/T 25876-2010 (GB/T25876-2010) | | Description (Translated English) | Method of nested PCR for sex identification of early cattle embryo | | Sector / Industry | National Standard (Recommended) | | Classification of Chinese Standard | B43 | | Classification of International Standard | 65.020.30 | | Word Count Estimation | 7,745 | | Date of Issue | 1/10/2011 | | Date of Implementation | 6/1/2011 | | Quoted Standard | GB/T 6682 | | Regulation (derived from) | Announcement of Newly Approved National Standards 2011 No. (No. 166 overall) 1 | | Issuing agency(ies) | General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, Standardization Administration of the People's Republic of China | | Summary | This Standard specifies cattle early embryo sexing nested PCR methods. This Standard is applicable to sex identification of cows and beef cattle embryo or fetus. | GB/T 25876-2010: Method of nested PCR for sex identification of early cattle embryo---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Method of nested PCR for sex identification of early cattle embryo
ICS 65.020.30
B43
National Standards of People's Republic of China
Bovine early embryo gender identification nested PCR
Issued on. 2011-01-10
2011-06-01 implementation
Administration of Quality Supervision, Inspection and Quarantine of People's Republic of China
Standardization Administration of China released
Foreword
Appendix B of this standard is a normative appendix, Appendix A is an information appendix.
The standard proposed by the People's Republic of China Ministry of Agriculture.
This standard by the National Standardization Technical Committee of animal husbandry.
This standard was drafted. Huazhong Agricultural University.
The main drafters of this standard. - selection of Yang Liguo, Li Xiang, Liu Hui, Liu move, Huxiu Zhong.
Bovine early embryo gender identification nested PCR
1 Scope
This standard specifies the nested PCR sexing of bovine early embryos.
This standard applies to dairy and beef sexing embryo or fetus.
2 Normative references
The following documents contain provisions which, through reference in this standard and become the standard terms. For dated references, subsequent
Amendments (not including errata content) or revisions do not apply to this standard, however, encourage the parties to the agreement are based on research
Whether the latest versions of these documents. For undated reference documents, the latest versions apply to this standard.
Laboratory use specifications and test methods GB/T 6682 Analysis
3 Terms and Definitions
The following terms and definitions apply to this standard.
3.1
Nested PCR nestedpolymerasechainreaction
The use of two sets of PCR primers (nested PCR primer pairs) two rounds of PCR amplification reaction, in the first round of amplification, the outer primer for production
Health amplification products, the presence of this product, including primers, DNA as a template, a second round of amplification.
3.2
SRY gene SRYgene
Male sex genes determine mammalian Y chromosome.
3.3
HBB gene HBBgene
β-globin gene, located on chromosome often.
Principle 4
The use of nested PCR reaction with high sensitivity and specificity of the characteristics of a small amount of SRY gene fragment was amplified embryonic cells to
HBB gene was amplified as a positive reference, electrophoresis PCR products amplified product according to the electrophoretic bands embryo gender identification.
5 primer
SRY1 5'CTACTCCCCAACCGTCAGAAC3 '
5'AGCCCAAACCCATCAACCTA3 '
SRY2 5'CCAGGGAACTGCTTGGGTA3 '
5'TGCTTCTCCACTTAGGCTCAA3 '
HBB 5'TATCCCACTTACAAGGCAGGTT3 '
|