Home Cart Quotation Policy About-Us
www.ChineseStandard.net
Database: 221581 (27 Mar 2026)
SEARCH
Path: Home > SN/T > Page48 > SN/T 4877.15-2019

SN/T 4877.15-2019 PDF English

Price & Delivery

US$259.00 · In stock · Download in 9 seconds
SN/T 4877.15-2019: (Gene barcode screening methods - Part 15: Phytophthora)
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See step-by-step procedure
Status: Valid
Std IDVersionUSDBuyDeliver [PDF] inTitle (Description)
SN/T 4877.15-2019English259 Add to Cart 3 days [Need to translate] (Gene barcode screening methods - Part 15: Phytophthora)

Click to Preview a similar PDF

Basic data

Standard ID SN/T 4877.15-2019 (SN/T4877.15-2019)
Description (Translated English) (Gene barcode screening methods - Part 15: Phytophthora)
Sector / Industry Commodity Inspection Standard (Recommended)
Classification of Chinese Standard C62
Word Count Estimation 12,145
Date of Issue 2019-09-03
Date of Implementation 2020-03-01
Regulation (derived from) Natural Resources Department Announcement No. 7 of 2019
Issuing agency(ies) General Administration of Customs

SN/T 4877.15-2019: (Gene barcode screening methods - Part 15: Phytophthora)


---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Gene barcode screening methods-Part 15. Phytophthora) ICS 65.002.01B16 People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard SN/T 478.15-2019 Genetic barcode screening method Part 15. Quarantine leaf spot Published.2019-2009-03 2020-03-01 implementation Published by the General Administration of Customs of the People's Republic of China ????? ????, ????, ??

Foreword

This section is drafted in accordance with the rules given in GB/T 1.1-2009. This section is proposed and managed by the General Administration of Customs of the People's Republic of China. This section was drafted. Ningbo Institute of Inspection and Quarantine Science and Technology, Ningbo Customs, People's Republic of China, Microbiology Research Institute, Chinese Academy of Sciences Institute, China Academy of Inspection and Quarantine. The main drafters of this section. Duan Weijun, Cai Lei, Guo Lixin, Chen Qian, Duan Lijun, Li Xuelian, Liu Fang, Zhao Wenjun, Chen Xianfeng. SN/T 478.15-2019 SN/T 4877 "Methods for Screening Gene Bar Codes" is divided into 15 parts. --Part 1. Quarantine Corynebacterium; --Part 2. Quarantine Xanthomonas; --Part 3. Quarantine phytoplasma; --Part 4. Phytophthora quarantine; --Part 5. Phytophthora quarantine; --Section 6. Quarantine Acidophilus; --Section 7. Quarantine Verticillium; --Part 8. Quarantine Anthrax; --Section 9. Quarantine --Part 10. Phytosanitary quarantine; --Part 11. Quarantine heterogeneous subgenus; --Part 12. Cucumber green mottle mosaic virus; --Part 13. Quarantine potato Y virus --Part 14. Quarantine Southern Bean Mosaic Virus; --Part 15. Quarantine leaf spot mold. This part is part 15 of SN/T 4877. ????? ????, ????, ?? Genetic barcode screening method Part 15. Quarantine leaf spot

1 Scope

This section specifies the quarantine leaf spot DNA screening method. This section applies to screening of quarantine leaf spot molds in imported plants and their products.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this article Pieces. For undated references, the latest version (including all amendments) applies to this document. SN/T 2589 Specification for detection of plant pathogenic fungi

3 Terms and definitions

The following terms and definitions apply to this document. 3.1 Phytophthora fungi spearieres), Dhodocomycetes, Ascomycota. A voucher specimen is a long-term preservation that provides a physical basis for identification or research and has sufficient archived information (collection and identification information, etc.) The specimen, it can be a complete biological individual or a part of it, or it can be the genetic material of the organism. The preservation of voucher specimens needs to be detailed Detailed specimen number, storage location and other detailed information for future verification. The DNA barcode refers to a species that can represent the species in the body, a standard, sufficiently mutated, easily amplified, and relatively short DNA Fragment. Researchers use DNA barcode technology to identify species and inter-species relationships, and modify existing taxonomic conclusions. The DNA barcode used to identify the quarantine Phytophthora is as follows. Ribosomal Gene Transcription Spacer (Internal Tracance Striper, ITS for short)

4 Method principle

According to the sequence characteristics of ribosomal transcribed spacer (ITS) of Phyllostachys sp Carry out species screening to determine whether the target fungus is quarantine leaf spot mold and its species classification. SN/T 487.7.15-2019??? ????, ????,?

5 instruments and reagents

5.1 Apparatus and equipment Microscope, autoclave, ultra-clean workbench, tissue breaker, thermostatic water bath, desktop refrigerated centrifuge, micro-spectrophotometer, electric Sub-balances, ultra-pure water meters, vortex shakers, refrigerators, micropipettes (0.5 μL, 2.5 μL, 10 μL, 20 μL,.200 μL, 1000 μL), conventional PCR instruments, nucleic acid electrophoresis instruments, gel imaging systems, DNA Extraction instrument. 5.2 Main reagents Purchase the following reagents or the corresponding fungal genome extraction kit. ethylenediamine tetraacetic acid sodium salt (Na2EDTA · 2H2O), hydrogen NaOH, Tris base, concentrated hydrochloric acid (HC1), cetyltrimethylammonium bromide (CTAB), sodium chloride (NaCl), polyvinylpyrrolidone (PVP), glacial acetic acid (CH3COOH), distilled water, chloroform (CHCl3), isoamyl alcohol, 70% ethanol. Reagents required for PCR and electrophoresis detection. 10 × PCR buffer, deoxyribonucleoside triphosphates (dNTPs), ExTaq polymerase, primer Materials, ultrapure water, DL2000 Marker, agarose, GelRed nucleic acid gel dye.

6 Screening and identification methods

6.1 Collection and processing of samples The collection, isolation, purification and cultivation of samples were performed in accordance with the quarantine and identification methods for plant pathogenic fungi of Sn/T 2589. 6.2 Preparation of nucleic acids Genomic extraction kits are used to prepare DNA, or modified CTAB extraction methods are used, see Appendix A. 6.3 Determination of DNA purity and concentration The purity and concentration of DNA were measured with a micro-ultraviolet spectrophotometer, and the absorption values at 260 nm and 280 nm were obtained, and the nucleus was calculated. The purity and concentration of the acid are calculated as follows. DNA purity = OD260/OD280 The concentration of DNA = 50 × OD260 μg/mL PCR-grade DNA solution should have an OD260/OD280 ratio of 1.7 to 1.9. 6.4 Sequence Amplification and Sequencing Amplify and sequence the ITS gene using universal primers (see Appendix B for specific steps), and place the sequence in the Genbank database or the Chinese inspection Alignment in the pest barcode DNA barcode database, if the sequence similarity with the Phyllostachys sp. ITS gene in the database is greater than 98%, then the sequence homology was analyzed.

7 result judgment

The length of the ITS gene sequence is greater than 500 bp, and it is carried out in the NCBI database or China ’s quarantine pest barcode database. Alignment analysis, if the homology with the Phyllostachys sp. ITS gene sequence (see Appendix C) in the database is greater than 98%, the bacteria is determined to be a leaf point Mold. If the determined sequence is 100% homologous to the reference sequence of the quarantine leaf spot mold of Appendix D, the bacteria is determined to be grape rot fungus. SN/T 487.7.15-2019??? ????, ????,?

8 save

8.1 Sample preservation Strains isolated and eventually identified as quarantine target fungi should be transferred to the test tube slope, and registered and signed at 4 ℃ Keep it in a low temperature refrigerator, and transfer it regularly (30d ~ 60d), and freeze it for a long time if necessary. 8.2 Records of results and data retention Complete experiment records include. sample source, type, time, experiment time, place, method and result, etc. Sign with the reviewer. Photographs of electrophoresis results are required for PCR gel electrophoresis detection, and sequences need to be saved in electronic files. SN/T 487.7.15-2019??? ????, ????,?

Appendix A

(Informative appendix) DNA extraction method A. 1 Take an appropriate amount of mycelia (500mg) and sterilized glass beads in a 2mL centrifuge tube, add 500μL 2 × CATA (60 ° C), and place the tissue cell wall on a tissue crusher. Incubate in a water bath for 30-60 minutes, occasionally shaking and mixing uniform; A. 2 Add 500 μL (1. 1, equal volume) of chloroform/isoamyl alcohol (24. 1), mix well (3 min), 2,000 rpm, and centrifuge for 15 min; A. 3 Extract the supernatant, add 250 μL (1. 1, equal volume) of chloroform/isoamyl alcohol (24. 1), 2,000 rpm, and centrifuge for 15 min; repeat this step once; A. 4 extract the supernatant, add an equal volume of isopropanol, mix well and precipitate for 30 min; A. 5 After precipitation, centrifuge at 12,000 rpm for 10 min; A. 6 Discard the liquid phase, add 400 μL of 70% ethanol, wash with shaking, and then centrifuge at 2,000 rpm for 5 min; repeat this step once; A. 7 Discard the liquid phase and dry the DNA in a clean bench, about 20 min; A. 8 Add 50 or 100 μL double distilled water (as appropriate) to dissolve the DNA sample, and store the sample at -20 ° C until use. SN/T 487.7.15-2019??? ????, ????,?

Appendix B

(Normative appendix) PCR amplification method Table B. 1 Amplification primers Target gene primer sequence amplified fragment ITS ITS1. TCCGTGAGGTTGAGACCTCGCGGGITTS4. TCCTCCCGCTTTATTAGATTGTC 644bp Table B. 2 PCR reaction system (Take 25μL as an example) Component volume (μL) dNTP mixture (10 mmol/mL each) 0.3 10 × PCR buffer (with Mg2 +) 2.5 Forward primer 1.0 Reverse primer 1.0 Tazyme 0.2 DNA template 1.0 ddH2O 19.0 Table B. 3 PCR reaction program (for gene ITS) Step reaction temperature (℃) Number of time cycles Pre-denaturing 94 5min- Denaturing 94 30S Annealing 52 30S Extension 72 1min Extension 72 10min- SN/T 487.7.15-2019??? ????, ????,?

Appendix C

(Informative appendix) Species Name Strain Number 1 Host Collection Site ITGSBenk Registration Number SN/T 487.7.15-2019??? ????, ????,? (Continued) Species Name Strain Number 1 Host Collection Site ITGSBenk Registration Number 1 Bacteria Collection Center CBS. Culture Collectio Cultral Affirmation Bureau Schwarmlines, Fungal Biodiversity Centre, U- trecht, TheNeterlends; IMI. Culture Colocionion iocafUUCceUkCentre, Egham, UK; ATCC. Amercian Type SN/T 487.7.15-2019??? ????, ????,? references WiekeeS, LombardL, NahimaC, MotoshaK, ChuateiroteE, CheowangkonR, McKenzieEHC, Hyde inMycologue76. 1-29. QhouN, ChenZ, CarrollG, ZhangN, ShivasRG, CaiL..2015. Pollyphachachracationitof ology 119. 433-446. SN/T 487.7.15-2019??? ????, ????,?
...

Refund Policy Privacy Policy Terms of Service