SN/T 4877.14-2019 English PDF

US$239.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
SN/T 4877.14-2019: DNA barcoding screening method - Part 13: Qurantine Sobemoviruses
Status: Valid

Standard ID	USD	BUY PDF	Lead-Days	Standard Title (Description)	Status
SN/T 4877.14-2019	239	Add to Cart	3 days	DNA barcoding screening method - Part 13: Qurantine Sobemoviruses	Valid

Similar standards

GBZ 57   GB/T 31989   SN/T 4877.15   SN/T 4877.13   SN/T 4877.12   

Basic data

Standard ID: SN/T 4877.14-2019 (SN/T4877.14-2019)
Description (Translated English): DNA barcoding screening method - Part 13: Qurantine Sobemoviruses
Sector / Industry: Commodity Inspection Standard (Recommended)
Classification of Chinese Standard: C62
Word Count Estimation: 11,175
Date of Issue: 2019-09-03
Date of Implementation: 2020-03-01
Regulation (derived from): Natural Resources Department Announcement No. 7 of 2019
Issuing agency(ies): General Administration of Customs

SN/T 4877.14-2019: DNA barcoding screening method - Part 13: Qurantine Sobemoviruses

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Gene barcode screening methods-Part 14. Quaternary southern bean mosaic virus) ICS 65.020B16 People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard SN/T 478.14-2019 Genetic barcode screening method Part 14. Quarantine southern bean mosaic virus Published.2019-2009-03 2020-03-01 implementation Published by the General Administration of Customs of the People's Republic of China ????? ????, ????, ??

Foreword

This section is drafted in accordance with the rules given in GB/T 1.1-2009. Please note that some elements of this document may involve patents. Publication of this document The agency is not responsible for identifying these patents. This section is proposed and managed by the General Administration of Customs of the People's Republic of China. This section was drafted. Beijing Customs of the People's Republic of China, Xiamen Customs of the People's Republic of China. The main drafters of this section. Deng Congliang, Chen Hongyun, Zhao Xiaoli, Lu Yufeng, Luo Weifeng, Liu Xingliang, and Zheng Chunsheng. SN/T 478.14-2019 SN/T 4877 "Methods for Screening Gene Bar Codes" is divided into 15 parts. --Part 1. Quarantine Corynebacterium; --Part 2. Quarantine Xanthomonas; --Part 3. Quarantine phytoplasma; --Part 4. Phytophthora quarantine; --Part 5. Phytophthora quarantine; --Section 6. Quarantine Acidophilus; --Section 7. Quarantine Verticillium; --Part 8. Quarantine Anthrax; --Section 9. Quarantine --Part 10. Phytosanitary quarantine; --Part 11. Quarantine heterogeneous subgenus; --Part 12. Cucumber green mottle mosaic virus; --Part 13. Quarantine potato Y virus --Part 14. Quarantine Southern Bean Mosaic Virus; --Part 15. Quarantine leaf spot mold. This section is part 14 of SN/T 4877. ????? ????, ????, ?? Genetic barcode screening method Part 14. Quarantine southern bean mosaic virus

1 Scope

This section specifies the RNA extraction, gene amplification, sequencing, and sequencing of quarantine southern bean mosaic virus virus gene barcode screening methods. Column comparison analysis and result determination. This section applies to the screening and detection of quarantine southern kidney mosaic virus in plant propagation materials and plant products.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this document. file. For undated references, the latest version (including all amendments) applies to this document. SN/T 3438 Southern bean mosaic virus quarantine and identification method. SN/T 3436 Quarantine mosaic virus quarantine and identification method.

3 Terms and definitions

The following terms and definitions apply to this document. DNA barcode refers to a standard, sufficiently mutated, easily amplified, and relatively short DNA that can represent the species in the organism. Fragment.

4 Basic Information on Southern Bean Mosaic Virus

Chinese name. Southern kidney bean mosaic virus This genus virus can infect monocotyledonous and dicotyledonous plants, but the natural host range of each virus is relatively narrow, and the disease symptoms are mainly flowers For additional information on the genus, see Appendix A.

5 Principle

That is the bar code characteristic sequence of this genus. Based on this conserved region, degenerate primers were designed, RT-PCR amplification and PCR product sequencing were performed. SN/T 478.14--2019 ????? ????, ????,?

6 Instruments and reagents

6.1 Instruments and facilities Enzyme-linked detector, electronic balance (sensibility. 0.0001g), qualitative PCR instrument, electrophoresis instrument, electrophoresis tank, gel imaging system, constant temperature water bath, low Refrigerators, ordinary refrigerators, centrifuges, etc .; micropipettes (2.5 μL, 10 μL, 20 μL, 100 μL,.200 μL, 1000 μL); enzyme-linked plates, mortars, etc .; isolation greenhouse. 6.2 Reagents See Appendix B for reagents.

7 Preparation

Pick out malformed, immature seeds and sown in sterilized soil. After growing 3-4 true leaves, number the plants that show symptoms, but no symptoms The plants are grouped (10 plants in 1 group) and numbered.

8 DNA barcode screening

The total RNA of the sample and the control were extracted separately, and cDNA was synthesized by reverse transcription, followed by PCR amplification. Healthy plant tissue negative As a result, the plant tissue infected with SBMV was used as a positive control, and sterile water was used as a blank control. See Appendix B for specific operations.

9 result judgment

9.1 If the general RT-PCR test result is negative, it is determined that no southern bean mosaic virus is detected. 9.2 If the general RT-PCR method detects a positive result, perform sequence determination and analysis. a) If the translated amino acid sequence is more than 95% homologous to a known viral sequence of the southern bean mosaic virus (see Appendix C), It is determined that Southern bean mosaic virus is detected (specific virus types need to be further identified by other methods). b) If the translated amino acid sequence is less than 95% homologous to a known virus sequence of the southern bean mosaic virus genus. --- If phylogenetic analysis indicates clustering with southern bean mosaic virus, it is determined that southern bean mosaic leaves are detected Virus is a virus (specific virus types need to be further identified by other methods); Note. The detected virus may belong to a known virus whose genome sequence has not been determined or a new virus species that has not been reported. --- If the phylogenetic analysis indicates that they are not clustered with the southern bean mosaic virus, it is determined that southern bean is not detected Mosaic virus. c) If the determined genomic sequence has the highest homology to the SBMV and SoMV viruses in the southern bean mosaic virus genus, determine Screening for quarantine plant viruses requires final identification according to standard methods (SN/T 3438 and Sn/T 3436). 10 Sample storage, results recording and data storage 10.1 Results Recording and Data Preservation Record sample information and test data, including sample source, plant species, sampling time and place, test time, method and results, and SN/T 478.14--2019 ????? ????, ????,? Signed by personnel. For RT-PCR detection methods, electrophoretic photographs should be saved, and sequencing reports should be saved for sequencing results. 10.2 Sample preservation Southern bean mosaic virus virus samples should be properly stored in an ultra-low temperature refrigerator, or stored at low temperature after lyophilization, and registered and Identification for review. SN/T 478.14--2019 ????? ????, ????,?

Appendix A

(Informative appendix) Southern bean mosaic virus A. Morphology of virion Southern bean mosaic virus virus virions are equiaxed icosahedron (T = 3), without envelope, about 30 nm in diameter and 180 Protein subunit, each protein subunit has two regions, one forming an icosahedral shell approximately 3.5 nm thick, and the other forming within the virus Partial sequence of "arms". A. 2 Genomic characteristics Leadframe (ORF) composition. ORF1, ORF2a, and ORF2b are all produced by translation of the genomic RNA, of which ORF2a is expressed through the leakage scanning mechanism; ORF2b forms a fusion protein with ORF2 through the -1 ribosome frameshift mechanism; ORF3 It is produced by subgenomic RNA translation. The motif encoding the replicase is located in ORF2b. A. 3 types of viruses SN/T 478.14--2019 ????? ????, ????,? A. 4 Host range After the virus, mosaic or mottled symptoms usually appear on the leaves. A. 5 Ways of transmission Spread by aphids, villous mottle virus (VTMoV) spreads through blind maggots. Some viruses can also be transmitted through seeds, such as southern vegetables Bean Mosaic Virus (SBMV), Southern Cowpea Mosaic Virus (SCPMV), and Quinoa Mosaic Virus (SoMV). SN/T 478.14--2019 ????? ????, ????,?

Appendix B

(Normative appendix) RT-PCR detection B. 1 reagent B. 1.2 Trichloromethane B. 1.3 isopropanol B. 1.4 75% ethanol B. 1.5 Deionized water (DEPC treatment) B. 1.6 50 × TAE Tris 242g 57.1mL of glacial acetic acid Na2EDA · 2H2O 37.2g Add deionized water and make up to 1L. Add water to dilute to 1 × TAE. B. 1.7 6 × loading buffer 0.25% bromophenol blue 40% (W/V) sucrose solution B. 2 Experimental steps B. 2.1 Total RNA extraction Weigh 0.1g of plant tissue plus liquid nitrogen and grind it into a powder form, quickly transfer it into a sterilized 1.5mL centrifuge tube, and add 1mL of TrizoL reagent, shake vigorously and shake to keep at room temperature for 5 min; centrifuge at 2,000 g for 10 min at 4 ° C, take the supernatant; add 0.2 mL of trichloromethane Mix with vigorous agitation and shaking; centrifuge at 2,000 g for 10 min at 4 ° C, take the supernatant; add 0.6 times the volume of isopropanol, mix by inversion, and keep at room temperature 5min; Centrifuge at 12 ° C for 10min at 4 ° C, discard the supernatant; wash the pellet with 75% ethanol, centrifuge at 7500g for 2min at 4 ° C, discard ethanol; After the precipitate is sufficiently dried at room temperature, it is dissolved in 30 μL of deionized water (DEPC treatment) and stored at -20 ° C until use. Equivalent kits can also be used to extract total RNA. B. 2.2 RT-PCR reaction See Table C for primers for RT-PCR detection. 1. 20 μL of cDNA synthesis reaction system. Add 6 μL of total RNA to a 0.2 mL reaction tube. 1 μL downstream primer Sobemo-RdRP-3 ′ (20 μmol/L), 4 μL deionized water, 10 μmol/LdNTPs 1 μL, 65 ℃ 5min, put it on ice immediately after taking out, add 5 × First Strand Buffer 4μL, 40U/μL RnaseBlockRockuplease Inhibitor 1μL, 0.1mol/LDT2μL, 42 ° C water bath for 2min, and then add.200U/μL RevereTrancecrispase 1μL, 50min in 42 ℃ water bath and 15min in 70 ℃ water bath after mixing to synthesize cDNA. FirstStrandBuffer and RevereTran- SN/T 478.14--2019 ????? ????, ????,? The amount of scriptase needs to be adjusted according to the brand of reverse transcriptase. A one-step RT-PCR kit can also be used for amplification. Table B. 1 Primer sequence Primer name sequence (5′-3 ′) Amplified fragment Somemo-RdRp-5 ′ Somemo-RdRp-3 ′ RTNCCCCCCATNGTRACACCA Approximately 400bp Note. N ... A, C, g, T; R ... A, g; D ... g, A, T The reaction system is shown in Table B. 2. Table B. 2 PCR reaction system Component volume (μL) Deionized water 38.5 10 × PCR Buffer (MgCl2plus) 5 dNTP (10mm) 2 Upstream primer (20 μM) 1 Downstream primer (20 μM) 1 T enzyme (5U/μL) 0.5 cdna 2 Total reaction volume 50 Reaction parameters. 95 ° C for 3 min; 95 ° C for 30 s; 55 ° C for 45 s; 72 ° C for 45 s; 35 cycles; 72 ° C for 7 min. Can also be used One-step RT-PCR kit for amplification. B. 2.3 Electrophoresis B. 2.3.1 Preparation of gel A 1.5% (W/V) agarose gel was prepared. Ethidium bromide can be directly added to agarose gel (concentration of 0.5 μg/mL), or stained with ethidium bromide after electrophoresis is completed. B. 2.3.2 Electrophoresis Mix 1 μL of 6 × loading buffer with 5 μL of the sample, and then add it to the wells of the appropriate DNA molecular weight standards. After the end of the electrophoresis, the agarose gel was placed on a UV transilluminator for observation, and the results were taken and retained. B. 3 result judgment B. 3.1 The positive control showed an amplification band of about 400 bp. The negative control and the blank control did not specifically amplify. B. 3.2 The positive control showed an amplification band of about 400 bp. The negative control and the blank control did not specifically amplify. Note 1. If necessary, further sequencing verification can be performed. SN/T 478.14--2019 ????? ????, ????,?

Appendix C

(Informative appendix) Quarantine southern bean mosaic virus gene reference sequence ＞ Souterbeammosaicvirus (NC_040060.2) CCCCCAAAAACCCTTGGTAGGCGCCCTTTTCGCCTCGCAACCGACCAAGCGCCAAAAGTCTGTCTTCAGCGATT TGAGAGGTCACAACATCTCTCTGTGTCTCTCTCGCGGTCGAACGCCCGATCATGCTGGTTTGTCGGTGC TGTTCCAAGAGCTGTGGAGGTGTTGGTCGTGGTAGAGGTAGGTAGGTAGGTATTAGTGGTGTGTTGTG ACAGAAGGTTGCTCCCATAGCGCCGTAGTGAATCGTCTCTGTCTCTAGCTACTAGCTCTCTGC CTCTCGGGATTGCGCACATCTCATCATAGATCAGACTAGCTCTCTGTGTATTAGTAGTCTGTGTCTCTATT GCACTCTCTCTCACACAAAACCTCCCAGAATATCGGTGTGCCTGTAGCTCTAGATCTTGGTCTTCCCCCTG GTTGATGCCGCCCATTGGGTGTAGTA ＞ Sowbenemos saicivirus (GZ 845002.2) CCCCCAAAAACCCTTGGTAGGCGCCCTTTTCGCCTCGCAACCGACCAAGCGCCAAAAGTCTGTCTTCAGCGATT TGAGAGGTCACAACATCTCTCTGTGTCTCTCTCGCGGTCGAACGCCCGATCATGCTGGTTTGTCGGTGC TGTTCCAAGAGCTGTGGAGGTGTTGGTCGTGGTAGAGGTAGGTAGGTAGGTATTAGTGGTGTGTTGTG ACAGAAGGTTGCTCCCATAGCGCCGTAGTGAATCGTCTCTGTCTCTAGCTACTAGCTCTCTGC CTCTCGGGATTGCGCACATCTCATCATAGATCAGACTAGCTCTCTGTGTATTAGTAGTCTGTGTCTCTATT GCACTCTCTCTCACACAAAACCTCCCAGAATATCGGTGTGCCTGTAGCTCTAGATCTTGGTCTTCCCCCTG GTTGATGCCGCCCATTGGGTGTAGTA SN/T 478.14--2019 ????? ????, ????,? ......

Image     

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of SN/T 4877.14-2019_English be delivered?

Answer: Upon your order, we will start to translate SN/T 4877.14-2019_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of SN/T 4877.14-2019_English with my colleagues?

Answer: Yes. The purchased PDF of SN/T 4877.14-2019_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.