Path:
Home >
SN/T >
Page48 > SN/T 5105-2019
Price & Delivery
US$199.00 · In stock · Download in 9 secondsSN/T 5105-2019: (Real-time fluorescent RT-PCR detection method for border port rotavirus (group B))
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See
step-by-step procedureStatus: Valid
| Std ID | Version | USD | Buy | Deliver [PDF] in | Title (Description) |
| SN/T 5105-2019 | English | 199 |
Add to Cart
|
3 days [Need to translate]
|
(Real-time fluorescent RT-PCR detection method for border port rotavirus (group B))
|
Click to Preview a similar PDF
Basic data
| Standard ID | SN/T 5105-2019 (SN/T5105-2019) |
| Description (Translated English) | (Real-time fluorescent RT-PCR detection method for border port rotavirus (group B)) |
| Sector / Industry | Commodity Inspection Standard (Recommended) |
| Classification of Chinese Standard | C62 |
| Word Count Estimation | 9,928 |
| Date of Issue | 2019-09-03 |
| Date of Implementation | 2020-03-01 |
| Regulation (derived from) | Natural Resources Department Announcement No. 7 of 2019 |
| Issuing agency(ies) | General Administration of Customs |
SN/T 5105-2019: (Real-time fluorescent RT-PCR detection method for border port rotavirus (group B))
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Real-time fluorescent RT-PCR detection method for border port rotavirus (group B))
ICS 11.020C62
People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard
SN/T 5105-2019
Real-time fluorescence of border port rotavirus (Group B)
RT-PCR detection method
Published.2019-2009-03
2020-03-01 implementation
Published by the General Administration of Customs of the People's Republic of China
????? ????, ????, ??
Foreword
This standard was drafted in accordance with the rules given in GB/T 1.1-2009.
This standard is proposed and managed by the General Administration of Customs of the People's Republic of China.
This standard was drafted. Gongbei Customs of the People ’s Republic of China, Xiamen Customs of the People ’s Republic of China, Shenzhen Customs of the People ’s Republic of China,
Shenzhen Institute of Metrology and Quality Inspection.
The main drafters of this standard. Mo Qiuhua, Yang Kunyu, Yang Ze, Wang Haibo, Shi Lei, Chen Jing, Chen Xinbin, Wu Jinshun, Tu Chengning, Shi Yongmei,
Yang Guowu.
SN/T 5105-201919 ????? ????, ????, ??
Real-time fluorescence of border port rotavirus (Group B)
RT-PCR detection method
1 Scope
This standard specifies the targets, detection methods, and results of real-time fluorescent RT-PCR for adult diarrhea rotavirus (Group B) at border crossings.
report.
This standard applies to laboratory testing of adult diarrhea rotavirus (Group B) at border crossings.
2 Normative references
The following documents are essential for the application of this document. For dated references, only the dated version applies to this article
Pieces. For undated references, the latest version (including all amendments) applies to this document.
GB 1849 General requirements for laboratory biosafety
SN/T 1720 Surveillance regulations for rotavirus infection at entry-exit ports
Application of polymerase chain reaction (PCR) in clinical diagnosis of WS/T 230
Directory of human-borne infectious pathogenic microorganisms (formerly Ministry of Health of the People's Republic of China)
3 Terms and definitions
The following terms and definitions apply to this document.
3.1
It is the main pathogen that causes diarrhea in humans, mammals and birds. Rotavirus has seven serogroups (A to G), of which A, B, and C groups can
Causes diarrhea in humans and animals. Group A rotavirus is the most common and it is the leading cause of diarrhea in infants and young children. Subject of group B rotavirus infection
It has an age limit and mainly infects young adults aged 15-45 years, but it can also infect the elderly and infants, so it is also called adult diarrhea rotavirus
(Adultairearotavirus, ADRV).
3.2
A technology that combines reverse transcription (RT) of RNA and polymerase chain amplification (PCR) of cDNA. This standard uses a one-step inversion
Transcription polymerase chain reaction (RT-PCR). In one-step RT-PCR, first using RNA as a template and using downstream specific primers,
Transcription and synthesis of complementary DNA (cDNA) under the action of RNA-dependent DNA polymerase (reverse transcriptase). This step is called "reverse transcription".
Then, using cDNA as a template, PCR amplification was performed by DNA polymerase using upstream and downstream specific primers.
Eventually, a specific region (target fragment) of the RNA molecule is amplified several million times.
3.3
Using fluorescent dyes or fluorescently-labeled specific fluorescent probes, the products of PCR amplification after reverse transcription are labeled and tracked.
The accumulation of optical signals enables real-time online monitoring of the entire PCR reaction process, and the corresponding software can be used for qualitative and quantitative analysis of the results.
SN/T 5105-201919 ????? ????, ????, ??
The fluorescent probe used in this standard is a molecular beacon probe. Molecular beacon probe is a fluorescently labeled oligo
The nucleotide chain usually contains 25 to 35 nucleotides. Structurally, the molecular beacon probe can be divided into three parts, namely the circular region, the stem region, and the fluorescence
And quenching groups. Loop region. generally composed of 15 to 30 nucleotides, which can specifically bind to the target molecule; stem region. oligonucleotide chain
A 5 to 8 base pair DNA double-stranded structure formed by complementary pairing of nucleic acid sequences at both ends, which can be used in the process of binding molecular beacons to target molecules.
Reversible dissociation occurs; fluorophores and quenching groups. fluorescent reporter groups (such as FAM) are generally attached at the 5 'end, and fluorescent quenching groups (such as
Dabcyl) is usually connected at the 3 'end. In the free state, the molecular beacon has a hairpin structure. At this time, because the fluorescent group and the quenching group rely on each other,
Nearly, the fluorescence is quenched; when combined with the target sequence, the spatial configuration of the molecular beacon changes, which makes the distance between the fluorescent group and the quenching group larger
At both ends of the extended probe, fluorescence was restored. Molecular beacon technology has high specificity, and is easy to operate and sensitive
High degree, especially it can be used for real-time quantitative detection, and can even be used for in vivo analysis.
3.4
In fluorescent PCR, the number of cycles that the fluorescence signal in each reaction tube goes through when it reaches a set threshold.
4 Abbreviations
The following abbreviations apply to this document.
DEPC. Diethylpyrocarbonate (diethylpyrocarbonate)
PAGE. polyacrylamide gel electrophoresis (polyacrylamide intermediates)
HPLC. High Performance Liquid Chromatography (HIGHPERFORMCELLIQIDROCHROMOTOGRAPHY)
bp. basepair
FAM. 6-carboxy-fluorescein
DABCZL. 4,4-dimethylamino-azobenzene-4'-carboxylic acid (4,4-dimethylamino-azobenzenene-4'-carboxylic
5 Detection object
5.1 Patients with acute gastroenteritis who have symptoms of vomiting, diarrhea, and fever, and suspected diarrhea virus infection, were found at border crossings.
5.2 Other personnel applying for inspection.
6 Biosafety and PCR anti-pollution requirements
Laboratory biosafety shall comply with the provisions of GB 1849 and "List of Pathogenic Microorganisms Transmitted by Humans". PCR pollution prevention measures
The provisions of WS/T 230 are implemented.
7 main instruments
The main equipment is as follows.
--- Class B biological safety cabinet;
--- Desktop high-speed refrigerated centrifuge (maximum centrifugal force above 12,000 × g);
--- Vortex oscillator;
--- Refrigerator. 4 ° C, -20 ° C and -70 ° C;
--- Ultra-clean workbench;
SN/T 5105-201919 ????? ????, ????, ??
--- Mini centrifuge;
--- Fluorescence quantitative PCR instrument;
--- Electronic balance (d = 1mg);
--- microwave oven;
---Electrophoresis;
--- autoclave;
--- Ultra-pure water or double steamer;
--- A set of micro-adjustable pipettes (including the following 5 specifications. 10μL, 20μL, 100μL,.200μL, 1mL).
8 main reagents
8.1 DEPC water without RNase.
8.2 Primers and probes. RT-PCR primers should be purified above PAGE, probes should be purified by HPLC, primers and probe sequences
See 9.2.3.1.
8.3 One-step fluorescence RT-PCR basic reagents. Bao Bioengineering (Dalian) Co., Ltd. One Step Primer Scrit TMTRT-PCR
(PerfreetTime) 1).
1) This information is provided for the convenience of users of this standard and does not indicate endorsement or recommendation of the product. If other equivalent products have the same
Effect, you can use these equivalent products.
9 Inspection procedures
9.1 Sample Collection
Collection of fecal specimens and vomit specimens was performed in accordance with Sn/T 1720.
9.2 Laboratory inspection
9.2.1 Sample processing
Take a stool sample or vomit with a size of about 100mg to.200mg of soybeans, or a water sample of 100μL to.200μL, add 800μL of physiological saline, shake vigorously and mix to make a 10% ～ 20% suspension. then 4 ℃, 800 × g centrifuge for 5 min; transfer supernatant to sterilized
Clean the centrifuge tube. When the test cannot be performed immediately, the samples are stored frozen in a -70 ° C ultra-low temperature refrigerator for future use.
9.2.2 Viral nucleic acid extraction
Take 150 μL of the processed sample, add 750 μL Trizol solution, shake and mix and leave it at room temperature for 5 minutes, then add.200 μL of chloroform, cover the centrifuge tube, shake and mix for 15 s, and leave it at room temperature for 5 minutes, 4 ° C, and centrifuge at 12,000 × g for 10 minutes. Take the upper aqueous phase to another
Add equal amount of isopropanol to the centrifuge tube to precipitate RNA, mix thoroughly and leave it at room temperature for 10 minutes, then centrifuge at 2,000 × g for 10 minutes, and discard the supernatant.
Add 1mL of 70% ethanol and wash once, centrifuge at 2,000 × g for 5min, discard the supernatant, and leave it at room temperature for 2min ~ 3min.
20μL ～ 50μL DEPC water (or other nucleic acid solubilizing solution) dissolves the nucleic acid precipitate, and after storage, store it at -70 ° C for future use.
9.2.2.2 Kit extraction and purification of nucleic acid method
Follow the commercial kit instructions for viral genome extraction.
SN/T 5105-201919 ????? ????, ????, ??
9.2.3 Real-time fluorescent RT-PCR detection
9.2.3.1 Primers and probes
The primer application solution concentration was formulated as 10 μmol/L. The probe application solution was formulated to a concentration of 5 μmol/L, and the 5 'and 3' ends of the probe were labeled with FAM and Dacyl, respectively.
The sequences of primers and probes are shown in Table 1.
Table 1 Rotavirus (group B) real-time fluorescent RT-PCR detection primers and probes
Primer/probe name sequence (5'-3 ') Amplified fragment
ADRV-FP ATTATATCTATGTAGTGTGTGCGTG
ADRV-RP ATTGCGATATACTCATCTCTAGGTC
ADRV-MBP FAM-CGATCGAGAGAGAGAGAGTAGHCTGCGCGTGCGCGTGCG-DABCZL
109bp
Note 1. In degenerate bases, M is A or C, and H is A or T or C.
Note 2. The underlined base is the part that forms the stem region of the molecular beacon probe.
Note 3. Equivalent primers and probes or other equivalent commercial detection kits can also be used.
9.2.3.2 Positive control and blank control settings
During the test, a positive control and a blank control were set. Positive controls are nucleic acids from adult diarrhea rotavirus (group B) positive samples, or
This is a part of the cloned rotavirus (group B). The RNA (which must include the amplified region) is transcribed and synthesized in vitro.
Appendix A; blank control with sterile water.
9.2.3.3 Reaction system composition
The one-step real-time fluorescence RT-PCR reaction system uses the following parameters. 2 × OnStepRT-PCRBuffer III (including dNTP and
Mg2 +, etc.) 12.5 μL; Primer ADRV-FP1.0 μL; Primer ADRV-RP 1.0 μL; Probe ADRV-P0.5 μL; 5.0 μL of template; make up to 25 μL with water. The RNA samples can be heat treated at 94 ° C for 3 min before being added, and then cooled on ice for 5 min.
9.2.3.4 Reaction conditions
One-step real-time fluorescence RT-PCR reaction conditions. reverse transcription at 42 ° C for 5 min; pre-denaturation at 95 ° C for 10 s; denaturation at 95 ° C for 5 s, and regression at 55 ° C
Fire for 35s, 68 ° C extension for 10s, 40 cycles; select FAM channel to collect fluorescence signal when annealing at 55 ° C; set ROX channel as a parameter
Than channel. Different laboratories can make appropriate adjustments based on the reagents and instruments used with reference to the above reaction conditions.
9.2.4 Judgment and report of test results
In the real-time fluorescence RT-PCR experiment, if the positive control has a significant increase in fluorescence, and the Ct value is within the expected range
(≤30); no fluorescence increase in the blank control indicates that the reaction system is operating normally and the results can be judged; otherwise, the test is deemed invalid
Need to retest.
When the results of the simultaneous positive control and blank control tests are normal, the test results of this method are determined and reported as follows.
--- The test sample has a clear fluorescence increase curve, and when the Ct value is ≤35, it is judged to be positive, and the report "Detection of adult diarrhea rotavirus (B
Group) specific genes (real-time fluorescence RT-PCR method) ";
--- When the Ct value of the fluorescence amplification curve of the detection sample is between 35 and 40, it is recommended to treat the nucleic acid sample by concentration method, and then repeat
SN/T 5105-201919 ????? ????, ????, ??
New real-time fluorescence RT-PCR detection. If the retested Ct value is still between 35 and 40, and the curve has a clear contrast
The number of growth periods was judged to be positive, and "the adult diarrhea rotavirus (group B) specific gene (real-time fluorescent RT-PCR) was detected
Method), such samples are recommended to be further verified by other methods; otherwise it is negative and reports "No adult diarrhea rotavirus detected
(Group B) Specific genes (real-time fluorescence RT-PCR method) ";
--- No fluorescence increase in the test sample, and it was judged as negative. "No adult diarrhea rotavirus (group B) specific gene (real-time
Fluorescence RT-PCR method) ".
SN/T 5105-201919 ????? ????, ????, ??
Appendix A
(Normative appendix)
A. 1 Adult diarrhea rotavirus (group B) GenBan reference sequence number. AZ21934.
A. 2 Positive control gene synthesis sequence.
ggtagaaattattacttctctacttctcttgttctgtggaggggctcctcctcctctgtcgcctctgacgcagtctcttctctctcttg
attcattgtagatgagatgagatatgatatgcatatgctatgat gtatttggcatttggcagatattacttccaagag
cagaa agacact gaga agac ag tg ag ag g a g a g a g a g c a g g a g c g c t c a a g a g a t a g a t g t t t c t c t c t c t c c t c t c t c t c t c t c t c t c t c t c tcc
acctccagacgcattcatccatccatccatggctgctcttccaatgagagataaaaacaaaac atacggaccatacacagataccactct
SN/T 5105-201919 ????? ????, ????, ??
...
