Path:
Home >
SN/T >
Page48 > SN/T 5100-2019
Price & Delivery
US$179.00 · In stock · Download in 9 secondsSN/T 5100-2019: Detection method for Kyasanur Forest disease virus by real-time fluorescence RT-PCR at frontier ports
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See
step-by-step procedureStatus: Valid
| Std ID | Version | USD | Buy | Deliver [PDF] in | Title (Description) |
| SN/T 5100-2019 | English | 179 |
Add to Cart
|
3 days [Need to translate]
|
Detection method for Kyasanur Forest disease virus by real-time fluorescence RT-PCR at frontier ports
|
Click to Preview a similar PDF
Basic data
| Standard ID | SN/T 5100-2019 (SN/T5100-2019) |
| Description (Translated English) | Detection method for Kyasanur Forest disease virus by real-time fluorescence RT-PCR at frontier ports |
| Sector / Industry | Commodity Inspection Standard (Recommended) |
| Classification of Chinese Standard | C62 |
| Word Count Estimation | 8,860 |
| Date of Issue | 2019-09-03 |
| Date of Implementation | 2020-03-01 |
| Regulation (derived from) | Natural Resources Department Announcement No. 7 of 2019 |
| Issuing agency(ies) | General Administration of Customs |
SN/T 5100-2019: Detection method for Kyasanur Forest disease virus by real-time fluorescence RT-PCR at frontier ports
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Real-time fluorescent RT-PCR detection method for Kasanoer forest disease virus at border port)
ICS 11.020C62
People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard
SN/T 5100-2019
Frontier Port Casanor Forest Disease Virus in Real Time
Fluorescent RT-PCR detection method
Published.2019-2009-03
2020-03-01 implementation
Published by the General Administration of Customs of the People's Republic of China
????? ????, ????, ??
Foreword
This standard was drafted in accordance with the rules given in GB/T 1.1-2009.
This standard is proposed and managed by the General Administration of Customs of the People's Republic of China.
This standard was drafted. China Academy of Inspection and Quarantine, Hangzhou Fuji Biotechnology Co., Ltd., Xinjiang International Travel Health Care
center.
The main drafters of this standard. Ma Xuezheng, Zhang Liping, Yang Yan, Hu Kongxin, and Sun Xiaohong.
SN/T 5100--2019 ????? ????, ????, ??
Frontier Port Casanor Forest Disease Virus in Real Time
Fluorescent RT-PCR detection method
1 Scope
This standard specifies the biosafety requirements for the detection of Casanor forest disease virus at border crossings, the collection, transportation and preservation of specimens, and specimens.
Processing, real-time fluorescent RT-PCR detection method for Casanor forest disease virus.
This standard applies to the detection of nucleic acids carried by persons entering or leaving the country at the border crossings.
2 Normative references
The following documents are essential for the application of this document. For dated references, only the dated version applies to this
file.
For undated references, the latest version (including all amendments) applies to this document.
GB 1849 General requirements for laboratory biosafety
Application of polymerase chain reaction (PCR) in clinical diagnosis of WS/T 230
General Guidelines for Biosafety in Pathogenic Microbiology Laboratories
Regulations on the Management of the Transport of Species or Species of Highly Pathogenic Pathogenic Microorganisms Infecting Humans
No. 45)
Measures for the Administration of Depository Institutions of Human-Transmitted Pathogenic Microorganisms (Poisons) (formerly the Ministry of Health of the People's Republic of China)
Directory of human-borne infectious pathogenic microorganisms (formerly Ministry of Health of the People's Republic of China)
3 Terms and definitions
The following terms and definitions apply to this document
3.1
The virus belongs to the mammalian tick-borne virus group of the Flaviviridae and was discovered in 1957. It originated from the forest of Kassanol in Nataka, India.
Sick monkey. Since then, 400 to 500 human cases have been reported each year. Symptoms of the disease include high fever and frontal headache, accompanied by
He has bleeding symptoms, such as nasal bleeding, throat bleeding, bleeding gums, and gastrointestinal bleeding. Ticks are the main vector of transmission and can cause fever,
Blood, myalgia, and encephalitis, with a mortality rate of 3% to 5%, are mainly distributed in western India. A researcher collected by Chinese researchers from 1989
Nanzianyinvirus was isolated from serum samples of fever patients and identified as a KFDV variant by molecular biology and other methods, suggesting that in my
KFD occurred in the Hengduan Mountains in Yunnan, China.
3.2
The real-time fluorescence RT-PCR method is based on the conventional RT-PCR, and a specific real-time fluorescence probe is added. The probe is
A segment of oligonucleotide with a reporter group and a quenched real-time fluorescent group at each end. When the probe is complete, the actual emission from the reporting group
The fluorescence signal is absorbed by the quenching group at the time; when the PCR is amplified, the 5'-3 'exonuclease activity of the Ta enzyme is used to degrade the probe to make the
When the fluorescent group and the quenching group are separated, the real-time fluorescence monitoring system can receive the real-time fluorescence signal. Real-time inside each reaction tube
The number of cycles that the fluorescence signal goes through when it reaches the set threshold is expressed by the value of Ct.
SN/T 5100--2019 ????? ????, ????, ??
3.3
The Ct value is the number of cycles that the fluorescence signal in each reaction tube goes through when it reaches a set threshold.
4 Abbreviations
The following abbreviations apply to this document.
DEPC. Diethylpyrocarbonate (diethylpyrocarbonate)
FAM. 6-carboxy-fluorescein
BHZ1. Black hole quenching group (blakehozuencher1)
5 Detection object
Suspicious cases found at the port of entry and exit.
6 Laboratory biosafety and PCR anti-pollution requirements
According to the requirements of GB 1849, "List of Pathogens Infecting Humans" and "Regulations on Management of Transportation of Species or Species of Highly Pathogenic Pathogens Infecting Humans", the biosafety requirements of relevant materials are as follows.
--- The degree of damage of the forest disease virus of Casanor No. 1 is classified into the first category;
--- Laboratories should follow GB 1849 and WS233. Operation of uncultured infectious materials should be performed in a Biosafety III (BSL-3 or ABSL-3) laboratory, and inactivated materials should be in Biosafety II ( BSL-2) performed in the laboratory;
--- Cassanoor forest disease virus infectious material transportation packaging is classified as Class A, and the UNI number is UNI 2814;
--- The used experimental supplies should be treated in accordance with GB 1849 for the treatment of waste.
--- Packing and transfer of suspected Casanor forest disease virus materials should comply with the former Order No. 45 of the Ministry of Health of the People's Republic of China;
--- PCR pollution prevention measures are implemented in accordance with the provisions of WS/T 230.
7 Instruments
The main instruments used in this method are as follows.
--- Real-time fluorescence PCR instrument;
--- Ultra-clean workbench;
--- Secondary biological safety cabinet;
--- autoclave;
--- Cryogenic high-speed centrifuge. Maximum centrifugal force.2000s.
--- Vortex oscillator;
--- Refrigerator. 4 ° C, -20 ° C and -70 ° C;
--- Pipette. 10 μL, 20 μL, 100 μL,.200 μL and 1 mL; --- constant temperature water bath;
--- Sterile syringe.
8 reagent
The main reagents used in this method are as follows.
SN/T 5100--2019 ????? ????, ????, ??
--- Nucleic Acid Extraction Reagent. Virus nucleic acid is extracted with ZIAgenVIRalRNA Kit from Germany Ziagen Company 1);
--- Real-time fluorescence RT-PCR reagent. Ag-Path-IDTM OnsiteRT-PCR2);
--- DEPC water without RNase.
--- Primer and probe sequences are shown in Table 1.
Table 1 Primers and probes for real-time fluorescent RT-PCR detection of Casanor forest disease virus
Primer/Probe Name Sequence (5'-3 ')
KFDV-F TGGAAGGCCCTGCGCTGAAAGAG
KFDV-R TCCATCCCCCTCGACCGCAT
KFDV-P FAM-ATTGAGAGAGAGCGCGCGCGTCCGCG-BHZ1
9 detection procedures
9.1 Collection of specimens
3 to 5 mL of venous blood was collected aseptically within 5 days after onset, centrifuged at 500 g for 10 min, and the serum was collected in a 2 mL sterile screw plastic tube.
The collected samples were numbered and registered with a low temperature oil-resistant marker.
9.2 Preservation of specimens
The collected specimens should be stored at 4 ° C. The biosafety requirements for sample storage should be in accordance with
Administrative Measures for Depository Institutions.
9.3 specimen transfer
The packaging and transfer of suspected Casanor forest disease virus-infected materials should be in accordance with "Highly pathogenic pathogenic microorganisms that can infect humans"
Real-time fluorescent RT-PCR reaction system configuration (in the system configuration area), in the order shown in Table 2, add.
Table 2 Components of the reaction solution for real-time fluorescence quantitative RT-PCR of nucleic acids of Casanor forest disease virus
Name dosage (μL)
RNA-free water 4
2 × RT-PCR Buffet 12.5
KFDV-F (10 μM) 1
KFDV-R (10 μM) 1
KFDV-P (10 μM) 0.5
25 × RT-PCRENYme 1
Template RNA 5
Total 25
Negative control and positive control are set up at the same time. The template of the positive control can be the nucleic acid of Cassanoir forest disease virus, or can be based on the virus
RNA fragment synthesized in vitro with acid sequence, negative control template is the sample without nucleic acid of Casanor forest disease virus or without RNase
Water.
Real-time fluorescence PCR reaction (in the nucleic acid amplification area). Transfer the sampled PCR reaction tubes to the real-time fluorescence PCR detector.
The amplification reaction was performed. The program was set to take ABI Prism 7500 automatic real-time fluorescence PCR detector as an example.
The settings are. ReporterDye1. FAM, CheckerDye1. BQ1, PassiveReference. ROX (depending on the selected real-time fluorescence
Depending on the PCR reaction reagent). The real-time fluorescence PCR amplification procedure was based on 45 ° C, 25min. pre-denaturation 95 ° C, 2min. denaturation 95 ° C,
In 15s, the annealing machine was extended at 60 ° C, 45s, and set for 40 cycles. The total reaction volume was 25 μL. Different laboratories can make appropriate adjustments based on the reagents and instruments used with reference to the above reaction conditions.
9.7 Analysis of results
9.7.1 Threshold determination
The threshold determination method is uniform for all specimens, and is generally based on the first 3 to 15 cycles of real-time fluorescence PCR reaction.
SN/T 5100--2019 ????? ????, ????, ??
The signal is used as the fluorescence background signal, and the standard deviation of the background signal is 10 times the fluorescence threshold. The real-time fluorescence signal generated by the amplification of the sample reaches the
The number of cycles when the fluorescence threshold is reached is the cycle threshold (Ct value).
9.7.2 Quality control
The reaction results should meet the following two conditions at the same time.
--- Negative control has no amplification curve, Ct value should show no amplification curve or ≥40;
--- Positive control Ct value < 35 and a significant amplification curve;
If the above two conditions are not met, the test result is invalid and needs to be redone.
9.8 result judgment
When the above two quality control conditions are met, the results are judged according to the following conditions.
--- Ct value should show no amplification curve or ≥40, and there is no obvious amplification curve, it is judged that the real-time fluorescence of Casanor forest disease virus
RT-PCR test is negative;
--- Ct value ≤ 36, and there is a significant amplification curve, preliminary judgment is positive for real-time fluorescent RT-PCR detection of Casanor forest disease virus;
--- Test sample 36 < Ct value < 40, a repeat experiment is required. If the Ct value is still between 36 and 40, and the curve is obvious
Exponential growth characteristics, while the negative control has no amplification curve, the sample can be reported as positive, otherwise the sample is reported as negative.
--- Real-time fluorescent RT-PCR-positive specimens should be further amplified by RT-PCR, which can sequence and compare the amplified fragments.
Determine if it is positive for Casanorr Forest Disease Virus.
SN/T 5100--2019 ????? ????, ????, ??
...
