Path:
Home >
SN/T >
Page48 > SN/T 5099-2019
Price & Delivery
US$179.00 · In stock · Download in 9 secondsSN/T 5099-2019: (Real-time fluorescent RT-PCR detection method for Hendra virus at border port)
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See
step-by-step procedureStatus: Valid
| Std ID | Version | USD | Buy | Deliver [PDF] in | Title (Description) |
| SN/T 5099-2019 | English | 179 |
Add to Cart
|
3 days [Need to translate]
|
(Real-time fluorescent RT-PCR detection method for Hendra virus at border port)
|
Click to Preview a similar PDF
Basic data
| Standard ID | SN/T 5099-2019 (SN/T5099-2019) |
| Description (Translated English) | (Real-time fluorescent RT-PCR detection method for Hendra virus at border port) |
| Sector / Industry | Commodity Inspection Standard (Recommended) |
| Classification of Chinese Standard | C62 |
| Word Count Estimation | 8,840 |
| Date of Issue | 2019-09-03 |
| Date of Implementation | 2020-03-01 |
| Regulation (derived from) | Natural Resources Department Announcement No. 7 of 2019 |
| Issuing agency(ies) | General Administration of Customs |
SN/T 5099-2019: (Real-time fluorescent RT-PCR detection method for Hendra virus at border port)
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Real-time fluorescent RT-PCR detection method for Hendra virus at border port)
ICS 11.020C62
People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard
SN/T 5099-2019
Real-time fluorescence of frontier port Hendra virus
RT-PCR detection method
Published.2019-2009-03
2020-03-01 implementation
Published by the General Administration of Customs of the People's Republic of China
????? ????, ????, ??
Foreword
This standard was drafted in accordance with the rules given in GB/T 1.1-2009.
This standard is proposed and managed by the General Administration of Customs of the People's Republic of China.
This standard was drafted. China Academy of Inspection and Quarantine, Xinjiang International Travel Health Care Center, Shenzhen Inspection and Quarantine Scientific Research Institute
Institute, Guangzhou Customs, People's Republic of China.
The main drafters of this standard. Ma Xuezheng, Yang Yan, Lin Yanru, Zhang Liping, Hu Kongxin, Shi Lei, and Sun Xiaohong.
SN/T 5099-2019 ????? ????, ????,?
Real-time fluorescence of frontier port Hendra virus
RT-PCR detection method
1 Scope
This standard specifies the biosafety requirements for Hendra virus testing at border crossings, the collection, transportation and preservation of specimens, and the handling of specimens.
Real-time fluorescence RT-PCR detection method for Della virus.
This standard applies to the detection of nucleic acids of Hendra virus carried by entry-exit personnel at border crossings.
2 Normative references
The following documents are essential for the application of this document. For dated references, only the dated version applies to this article
Pieces. For undated references, the latest version (including all amendments) applies to this document.
GB 1849 General requirements for laboratory biosafety
Application of polymerase chain reaction (PCR) in clinical diagnosis of WS/T 230
WS233 General Guidelines for Biosafety in Pathogenic Microbiology Laboratories
Regulations on the Management of Transportation of Highly Pathogenic Pathogenic Microorganism Bacteria (Virus) or Samples that Infect Humans
Number 45)
Measures for the Administration of Depository Institutions of Human-Transmitted Pathogenic Microorganisms (Poisons) (formerly the Ministry of Health of the People's Republic of China)
Directory of human-borne infectious pathogenic microorganisms (formerly Ministry of Health of the People's Republic of China)
3 Terms and definitions
The following terms and definitions apply to this document
3.1
do not. Hendra virus is a zoonotic virus that was first reported in.1994 by Hendra in the suburb of Brisbane, Queensland, Australia
Found to cause severe respiratory diseases. So far, human cases of HeV infection have been those in close contact with infected horses.
Therefore close contact is one of the routes of transmission of HeV. Diseases caused by HeV virus are typically characterized by severe dyspnea and high mortality
The rate is also manifested in human contact infections. Humans have significant respiratory symptoms in the early onset of infection, with fever and myalgia; some appear nerves
Symptoms, often with moderate encephalitis.
3.2
The real-time fluorescence RT-PCR method is based on the conventional RT-PCR, and a specific real-time fluorescence probe is added. The probe is
A segment of oligonucleotide with a reporter group and a quenched real-time fluorescent group at each end. When the probe is complete, the actual emission from the reporting group
The fluorescence signal is absorbed by the quenching group at the time. during PCR amplification, the 5'-3 'exonuclease activity of the Ta enzyme is used to digest the probe to degrade the
When the fluorescent group and the quenching group are separated, the real-time fluorescence monitoring system can receive the real-time fluorescence signal. Real-time inside each reaction tube
The number of cycles that the fluorescence signal goes through when it reaches the set threshold is expressed by the value of Ct.
SN/T 5099-2019 ????? ????, ????,?
3.3
The Ct value is the number of cycles that the fluorescence signal in each reaction tube goes through when it reaches a set threshold.
4 Abbreviations
The following abbreviations apply to this document.
DEPC. Diethylpyrocarbonate (diethylpyrocarbonate)
FAM. 6-carboxy-fluorescein (6-carboxy-fluorescein)
BHZl. black hole quenching group
5 Detection object
Suspicious cases found at the port of entry and exit.
6 Laboratory biosafety and PCR anti-pollution requirements
According to GB 1849, "List of Human-Transmitted Pathogenic Microorganisms" and "Highly Pathogenic Pathogenic Microorganisms (Poison) Species that Infect Humans"
The requirements of the “Regulations for the Management of Sample Transportation”, the biosafety requirements of the relevant materials are as follows.
--- Hendra virus damage is classified into the first category;
--- Personal protection complies with GB 1849;
--- Laboratories should follow GB 1849 and WS233. The operation of uncultured infectious materials should be at Biosafety III (BSL-3).
Or ABSL-3) in the laboratory, and inactivated materials in the biosafety class II (BSL-2) laboratory;
--- Hendra virus infectious material transport packaging is classified as Class A, and the UNI number is UNI 2814;
--- The used experimental supplies should be treated in accordance with GB 1849 for the treatment of waste;
--- The packaging and transfer of suspected Hendra virus materials should comply with the former Order No. 45 of the Ministry of Health of the People's Republic of China
--- PCR pollution prevention measures are implemented in accordance with the provisions of WS/T 230.
7 Instruments
The main instruments used in this standard are as follows.
--- Real-time fluorescence PCR instrument;
--- Ultra-clean workbench;
--- Secondary biological safety cabinet;
--- autoclave;
--- Low temperature high-speed centrifuge. maximum centrifugal force.2000g;
--- Vortex oscillator;
--- Refrigerator. 4 ° C, -20 ° C and -70 ° C;
--- Pipette. 10 μL, 20 μL, 100 μL,.200 μL and 1 mL; --- constant temperature water bath;
--- Sterile syringe.
SN/T 5099-2019 ????? ????, ????,?
8 reagent
The main reagents used in this method are as follows.
--- Nucleic acid extraction reagent. ZIAMPVIRALRNA Kit from Germany Oiagen Company extracted virus nucleic acid 1);
--- Real-time fluorescent RT-PCR reagent. Ag-Path-IDTM OnsiteRT-PCR Kit, product of American company Amion 2);
1) and 2) are provided by the designated unit. This information is provided for the convenience of users of this standard and does not indicate approval of the product. If other equivalent products
Have the same effect, you can use these equivalent products.
--- DEPC water without RNase;
--- Primer and probe sequences are shown in Table 1.
Table 1 Primers and probes for real-time fluorescence RT-PCR detection of Hendra virus
Primer/Probe Name Sequence (5'-3 ')
HeV-F CTTCGACACAGAGACGACGACACAA
HeV-R CCCACGCTCGGTCGAGCACAAAAT
HeV-P FM-TGCGCATCTCTCTCTCTCTCGCT-CGRAM-TAMRA
9 detection procedures
9.1 Collection of specimens
3 to 5 mL of venous blood was collected aseptically within 5 days after onset, centrifuged at 500 g for 10 min, and the serum was collected in a 2 mL sterile screw plastic tube.
The collected samples were numbered and registered with a low temperature oil-resistant marker.
9.2 Preservation of specimens
The collected specimens should be stored at 4 ° C. The biosafety requirements for sample storage should be in accordance with
Table 2 Components of Hendra virus nucleic acid real-time quantitative RT-PGR detection reagent reaction solution
Name dosage (μL)
RNA-free water 4
2 × RT-PCR Buffet 12.5
Hev-F (10 μM) 1
Hev-R (10 μM) 1
Hev-P (10 μM) 0.5
25 × RT-PCRENYme 1
Template RNA 5
Total 25
Negative control and positive control are set up at the same time. The template of the positive control can be Hendra virus nucleic acid or can be based on the nucleotide sequence of the virus.
For externally synthesized RNA fragments, the negative control template was a sample without Hendra virus nucleic acid or RNase-free water.
9.6 Real-time fluorescent RT-PGR amplification reaction
Real-time fluorescence PCR reaction (in the nucleic acid amplification area). Transfer the sampled PCR reaction tubes to the real-time fluorescence PCR detector.
The amplification reaction was performed. The program was set to take ABI Prism 7500 automatic real-time fluorescence PCR detector as an example.
The number is set to. ReporterDyer. FAM, CheckerDyer. TAM, PassiveReference. ROX (depending on the selected real-time fluorescence
Depending on the PCR reaction reagent). The real-time fluorescence PCR amplification program is. 48 ° C 30min, 95 ° C 10min; 95 ° C 15s, 60 ° C 1min
(Collect fluorescence signals), 45 cycles. If other instruments are used, specific reaction conditions should be set according to the requirements of other instruments.
9.7 Analysis of results
9.7.1 Threshold determination
The threshold determination method is uniform for all specimens, and is generally based on the first 3 to 15 cycles of real-time fluorescence PCR reaction.
SN/T 5099-2019 ????? ????, ????,?
The signal is used as the fluorescence background signal, and the standard deviation of the background signal is 10 times the fluorescence threshold. The real-time fluorescence signal generated by the amplification of the sample reaches the
The number of cycles when the fluorescence threshold is reached is the cycle threshold (Ct value).
9.7.2 Quality control
The reaction results should meet the following two conditions at the same time.
--- Negative control has no amplification curve, Ct value should show no amplification curve or ≥40;
--- Positive control Ct value < 35 and a significant amplification curve.
If the above two conditions are not met, the test result is invalid and needs to be redone.
9.8 result judgment
When the above two quality control conditions are met, the results are judged according to the following conditions.
--- Ct value should show no amplification curve or ≥40, and there is no obvious amplification curve, judged as real-time fluorescence RT-PCR detection of Hendra virus
Negative test
--- Ct value is less than 36, and there is a significant amplification curve, and it is preliminarily judged that the real-time fluorescence RT-PCR test of Hendra virus is positive;
--- Test sample 36 < Ct value < 40, a repeat experiment is required. If the Ct value is still between 36 and 40, and the curve is obvious
Exponential growth characteristics, while the negative control has no amplification curve, the sample can be reported as positive, otherwise the sample is reported as negative;
--- Real-time fluorescent RT-PCR-positive specimens should be further amplified by RT-PCR, which can sequence and compare the amplified fragments.
Determine if they are positive for Hendra virus nucleic acid.
SN/T 5099-2019 ????? ????, ????,?
...
