Path:
Home >
SN/T >
Page48 > SN/T 5097-2019
Price & Delivery
US$199.00 · In stock · Download in 9 secondsSN/T 5097-2019: (Real-time fluorescent RT-PCR detection method for rumored Bajia virus in border ports)
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See
step-by-step procedureStatus: Valid
| Std ID | Version | USD | Buy | Deliver [PDF] in | Title (Description) |
| SN/T 5097-2019 | English | 199 |
Add to Cart
|
3 days [Need to translate]
|
(Real-time fluorescent RT-PCR detection method for rumored Bajia virus in border ports)
|
Click to Preview a similar PDF
Basic data
| Standard ID | SN/T 5097-2019 (SN/T5097-2019) |
| Description (Translated English) | (Real-time fluorescent RT-PCR detection method for rumored Bajia virus in border ports) |
| Sector / Industry | Commodity Inspection Standard (Recommended) |
| Classification of Chinese Standard | C62 |
| Word Count Estimation | 9,936 |
| Date of Issue | 2019-09-03 |
| Date of Implementation | 2020-03-01 |
| Regulation (derived from) | Natural Resources Department Announcement No. 7 of 2019 |
| Issuing agency(ies) | General Administration of Customs |
SN/T 5097-2019: (Real-time fluorescent RT-PCR detection method for rumored Bajia virus in border ports)
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Real-time fluorescent RT-PCR detection method for rumored Bajia virus in border ports)
People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard
Real-time RT-PCR detection method for tick-borne Baja virus at border crossings
Real-time RT-PCR method for detecting Bhanja virus
in ticks at frontier ports
2019-09-03 Release
2020-03-01 implementation
Published by the General Administration of Customs of the People's Republic of China
ICS 11.020
C 62
Tick-borne Baja virus.indd 1.2019/9/12 14.01.05
????? ????, ????, ??
Tick-borne Baja virus.indd 2.2019/9/12 14.01.05
????? ????, ????, ??
Foreword
This standard was drafted in accordance with the rules given in GB/T 1.1-2009.
This standard is proposed and managed by the General Administration of Customs of the People's Republic of China.
This standard was drafted. China Academy of Inspection and Quarantine, Guangzhou Customs of the People's Republic of China, Shenzhen Inspection and Quarantine Science
Research Institute, Hohhot Customs, People's Republic of China.
The main drafters of this standard. Liu Lijuan, Cao Xiaomei, Liu Xingyu, Shi Lei, Yang Yu, Xu Baoliang, Guo Tianyu, Zhang Sheng, Wang Jing.
Tick-borne Baja virus.indd 1.2019/9/12 14.01.05
????? ????, ????, ??
Tick-borne Baja virus.indd 2.2019/9/12 14.01.05
????? ????, ????, ??
Real-time RT-PCR detection method for tick-borne Baja virus at border crossings
1 Scope
This standard specifies the detection targets, biological safety, and PCR antifouling of tick-borne Baja virus real-time fluorescence RT-PCR detection at border crossings.
Dyeing requirements, instruments, reagents and inspection procedures.
This standard applies to the detection of tick-borne Baja virus.
2 Normative references
The following documents are essential for the application of this document. For dated references, only the dated version applies to this article
Pieces. For undated references, the latest version (including all amendments) applies to this document.
GB 19489 General requirements for laboratory biosafety
SN/T 1293 Tick monitoring regulations at border crossings
Application of polymerase chain reaction (PCR) technology in WS/T 230 clinical diagnosis
List of pathogenic microorganisms transmitted from human to human (Ministry of Health of the People's Republic of China Health Science and Education [2006] No. 15)
3 terms and definitions
The following terms and definitions apply to this document.
3.1
Bajaja virus; BHAV
A member of the Buniaviridae family of white cricket virus, a single-stranded negative-segment RNA virus with S, M, and L fragments. Among them, L slice
Segments encode RNA-dependent RNA polymerases, M fragments encode glycoproteins Gn and Gc, and S fragments encode nucleocapsid and non-structural proteins.
BHAV is mainly transmitted by tick bites, causing illness in humans and livestock. Under normal circumstances, a person infected with BHAV may experience lethargy, vomiting,
Nervous system symptoms such as meningitis and paralysis; abortion and death may occur after infection in livestock.
4 Acronyms
The following abbreviations apply to this document.
bp. base pair
Ct value. cycle threshold
DEPC. diethyl pyrocarbonate
FAM. 6-carboxy-fluorescein
RNA. ribonucleic acid
ROX. 6-carboxy-x-rhodamine
RT-PCR. reverse transcription polymerase chain reation
Tick-borne Baja virus.indd 1.2019/9/12 14.01.05
????? ????, ????, ??
5 Detection objects
5.1 Tick samples collected on-site at border crossings.
5.2 Persons suspected of being bitten by ticks and unable to rule out Baja virus infection.
6 Biosafety and PCR anti-pollution requirements
6.1 Biosafety requirements
Biosafety requirements for Baja virus-related materials in accordance with the requirements of GB 19489 and the Directory of Pathogens in Human Infections
as follows.
-The degree of harm of Baja virus is classified as the third category;
-Handling of uncultured Baja virus infectious material should be performed in a Biosafety Level 2 (BSL-2) laboratory;
-Baja virus-related inactivated and non-infectious materials can be handled in a Biosafety Level 1 (BSL-1) laboratory;
-Baja virus infectious materials are transported and packaged in Category B, UN number UN 3373.
6.2 PCR anti-contamination requirements
PCR anti-contamination measures are implemented in accordance with WS/T 230.
7 instruments
7.1 Real-time PCR instrument.
7.2 Secondary biological safety cabinet.
7.3 Autoclave.
7.4 -70 ℃ ultra-low temperature refrigerator.
7.5 Benchtop centrifuge.
7.6 Vortex oscillator.
8 reagent
8.1 DEPC water
DEPC-treated RNase-free water.
8.2 RNA extraction kit
QIAamp Viral RNA Kit, see the kit manual for details, including AVL, AW1, AW2, and AVE1). a
8.3 One-Step Fluorescent RT-PCR Kit
Ag-Path-IDTM One step RT-PCR Kit2). b
1) This information is provided for the convenience of users of this standard and does not indicate endorsement of the product. If other equivalent products have the same effect,
These equivalent products can be used.
2) This information is provided for the convenience of users of this standard and does not indicate endorsement of the product. If other equivalent products have the same effect,
These equivalent products can be used.
Tick-borne Baja virus.indd 2.2019/9/12 14.01.05
????? ????, ????, ??
8.4 Primers and probes
The sequence is shown in Table 1.
Table 1 Primer and probe sequences
Primer/Probe Name Sequence (5'-3 ') Monitoring Period
F GATGGTTGCATACACTGA
Amplified fragment is 166 bpR CTTGGCATCATCTTTCCA
Probe FAM- ATCCTTAAGGAGTTCGGTGAGGA -BHQ1
Note. The 5 'end of the probe is labeled with the FAM fluorescent reporter and the 3' end is labeled with the BHQ1 fluorescent quenching group. Other equivalent fluorescent markers and
Quenching groups or equivalent primers and probes or other equivalent commercially available detection kits can also be used.
9 Inspection procedures
9.1 Sample collection
9.1.1 Collection of tick samples
According to SN/T 1293.
9.1.2 Collection of human serum samples
5 mL of internal venous blood was collected aseptically within 3 days of the onset of the suspected case, and allowed to stand at room temperature for 30 minutes to coagulate, and centrifuged at 1 500 r/min ~ 3 000 r/min
After 10 minutes, the serum was collected in a 2 mL sterile screw-top plastic tube, registered with a low-temperature oil-resistant marker, and sent to the laboratory for testing at low temperatures.
If it cannot be delivered to the laboratory within 24 hours, the serum should be stored in a refrigerator at -70 ° C.
9.2 Laboratory inspection
9.2.1 Sample processing
9.2.1.1 Tick samples
On the sterile operation platform, take out the ticks and place them in sterile dishes, soak them in 75% alcohol for 20 minutes, and blot them with sterile filter paper.
Alcohol on the surface, rinse 3 times with normal saline, blot dry the surface of the tick with sterile filter paper, pour into the mill, add 1 mL of PBS
Or wash with normal saline, discard the liquid, add 1 mL of PBS or normal saline, and repeatedly grind until the tissue fragments have basically disappeared, and then
The grinding solution was sucked into a 1.5 mL centrifuge tube, and the centrifuge was pre-cooled at 4 ℃ at 20 000 r/min and centrifuged for 10 minutes.
Acid extraction.
9.2.1.2 Serum samples
Serum samples are directly extracted from molecular biological nucleic acids. If they cannot be detected in 24 hours, they should be stored in -70 ℃ refrigerator.
Tick-borne Baja virus.indd 3.2019/9/12 14.01.05
????? ????, ????, ??
9.2.2 Viral nucleic acid extraction
Refer to the instructions of the commercial RNA nucleic acid extraction kit, see Appendix A.
9.2.3 Real-time fluorescent RT-PCR detection
9.2.3.1 Primers and probes
Primer and probe application solutions were formulated to a concentration of 10 μmol/L, and the amplified fragment size was 166 bp. The 5 'and 3' ends of the probe are FAM
And BHQ1 mark.
9.2.3.2 Positive control and blank control settings
During the test, a positive control and a blank control were set. The positive control is part of the nucleotide sequence of cloned Baja virus (should include
Contains amplified region) cDNA synthesized in vitro; blank control uses sterile water.
9.2.3.3 Reaction system composition
The reaction system composition is shown in Table 2.
Table 2 Reaction system of real-time fluorescence RT-PCR of Baja virus
Unit is microliter (μL)
Component volume
DEPC water 4.5
2 × RT-PCR buffer 12.5
10 μmol/L upstream primer 1
10 μmol/L downstream primer 1
10 μmol/L probe 0.5
Enzyme mixture 0.5
Template RNA/negative control/positive control 5
Note. The total reaction system for real-time RT-PCR of Baja virus is 25 μL.
9.2.3.4 Reaction conditions
The one-step real-time fluorescent RT-PCR detection amplification conditions are. 45 ℃ for 10 min once; 95 ℃ for 10 min once; 95 ℃ for 15 s.
60 ℃ for 45 s, a total of 40 cycles. A fluorescence signal is collected at the end of each cycle. Select the FAM channel to collect the fluorescence signal when annealing at 60 ℃;
Set the ROX channel as the reference channel. Different laboratories can make appropriate adjustments based on the reagents and instruments used with reference to the above reaction conditions.
9.2.4 Inspection result judgment and report
9.2.4.1 Threshold determination
The threshold determination method is uniform for all samples. Generally, the first 3 to 15 cycles of real-time
The optical signal is used as the fluorescence background signal, and 10 times the standard deviation of the background signal is used as the fluorescence threshold.
The number of cycles when the fluorescence threshold is reached is the cycle threshold (Ct value).
Tick-borne Baja virus.indd 4.2019/9/12 14.01.05
????? ????, ????, ??
9.2.4.2 Quality control
The reaction result should meet the following two conditions at the same time.
-No amplification curve appears for the negative control;
-The positive control has a Ct value ≤ 35 and a significant amplification curve.
9.2.4.3 Judgment and Report of Results
When the results of the simultaneous positive control and blank control tests are normal, the test results of this method are determined and reported as follows.
-The test sample has a clear fluorescence amplification curve, and when the Ct value is ≤ 35, it is judged to be positive, and the "specificity of Baja virus detected" is reported.
Genes (Real-time fluorescent RT-PCR). "
-When the Ct value of the fluorescence amplification curve of the test sample is between 35 and 40, it is recommended to perform a real-time fluorescence RT-PCR test again.
If the retested Ct value is still between 35 and 40, and the curve has a significant logarithmic growth period, it is judged as positive, and the report "Baja detected
Virus-specific genes (real-time fluorescent RT-PCR) ", such samples are recommended to be further verified by other methods; otherwise it is negative
The report "Baja virus-specific genes were not detected (real-time fluorescent RT-PCR)."
-The test sample was negative for fluorescent amplification and was judged negative, and reported that "Baja virus-specific genes were not detected (real-time fluorescence
RT-PCR method). "
Tick-borne Baja virus.indd 5.2019/9/12 14.01.05
????? ????, ????, ??
Appendix A
(Informative appendix)
RNA virus nucleic acid extraction
A.1 Take 140 μL of tick sample grinding solution or cell culture supernatant, add 560 μL of Lysis Solution (AVL), and shake on a vortex mixer
Mix for 15 s and let stand at room temperature for 10 min.
A.2 Add 560 μL of absolute ethanol to stop the reaction, and shake on a vortex mixer for 15 s to mix.
A.3 The lysed liquid is transferred into the column twice and centrifuged at 8 000 r/min for 1 minute each time. At this time, viral RNA will be adsorbed on the column
On the bottom of the membrane.
A.4 Add 500 μL of washing solution (AW1) to the column, centrifuge at 8 000 r/min for 1 minute each time, and discard AW1.
A.5 Add 500 μL of washing solution (AW2) to the column, centrifuge at 14 000 r/min for 3 min each time, discard AW2, and further separate
Heart 14 000 r/min for 1 min to completely remove the residual ethanol on the membrane.
A.6 Add 60 μL of eluent (AVE) and let stand at room temperature for 1 min.
A.7 Place the column on a 1.5 mL centrifuge tube, and centrifuge at 8000 r/min for 1 min at 4 ℃. The obtained RNA can be real-time fluorescent.
RT-PCR detection.
Tick-borne Baja virus.indd 6.2019/9/12 14.01.05
????? ????, ????, ??
...
