|
US$439.00 · In stock
Delivery: <= 4 days. True-PDF full-copy in English will be manually translated and delivered via email.
WS 295-2019: Diagnosis for meningococcal meningitis
Status: Valid WS 295: Evolution and historical versions
| Standard ID | Contents [version] | USD | STEP2 | [PDF] delivered in | Standard Title (Description) | Status | PDF |
| WS 295-2019 | English | 439 |
Add to Cart
|
4 days [Need to translate]
|
Diagnosis for meningococcal meningitis
| Valid |
WS 295-2019
|
| WS/T 295-2019 | English | 419 |
Add to Cart
|
4 days [Need to translate]
|
(Diagnosis of epidemic cerebrospinal meningitis)
| |
WS/T 295-2019
|
| WS 295-2008 | English | 439 |
Add to Cart
|
3 days [Need to translate]
|
Diagnostic criteria for epidemic cerebrospinal meningitis
| Obsolete |
WS 295-2008
|
PDF similar to WS 295-2019
Basic data | Standard ID | WS 295-2019 (WS295-2019) | | Description (Translated English) | Diagnosis for meningococcal meningitis | | Sector / Industry | Health Industry Standard | | Classification of Chinese Standard | C59 | | Classification of International Standard | 11.020 | | Word Count Estimation | 19,160 | | Date of Issue | 2019 | | Date of Implementation | 2019-07-01 | | Issuing agency(ies) | National Health Commission | WS 295-2019: Diagnosis for meningococcal meningitis---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Diagnosis for meningococcal meningitis
ICS 11.020
C 59
WS
People's Republic of China Health Industry Standard
Replacing WS 295-2008
Diagnosis of epidemic cerebrospinal meningitis
Published on.2019 - 01 - 02
2019 - 07 - 01 implementation
National Health and Wellness Committee of the People's Republic of China
Foreword
5.1, 5.2, and 5.3 of this standard are mandatory and the rest are recommended.
This standard was drafted in accordance with the rules given in GB/T 1.1-2009.
This standard replaces WS 295-2008 "Diagnostic Criteria for Epidemic Cerebrospinal Meningitis."
Compared with WS 295-2008, the main technical changes of this standard are as follows.
- Added abbreviations (see Chapter 2);
- Revised the history of epidemiology (see 3.1, 2.1 of the.2008 edition);
-- Revised clinical performance (see 3.2,.2008 version 2.2);
-- Revised the "peripheral blood image" as "blood routine" (see 3.3.1, 2.3.1 of the.2008 edition);
- increased the results of cerebrospinal fluid examination (see 3.3.2);
- Added "defective (spot) tissue fluid" (see 3.3.3.2 and 3.3.3.3);
- Revised the diagnostic principle (see 4,.2008 edition 3);
- Revised "serology" to "immunology" (see 3.3.4,.2008 version 2.3.4);
- Revised suspected cases (see 5.1,.2008 edition 4.2);
-- Revised clinically diagnosed cases (see 5.2,.2008 edition 4.3);
- Revised confirmed cases (see 5.3, 4.4 of the.2008 edition);
- Added "other meningococcal disease" (see 7.2);
- Added "differential diagnosis" (see Appendix B, B.4);
-- Modified the laboratory test method for Neisseria meningitidis (see Appendix A);
-- According to changes in the epidemiological characteristics of epidemic cerebrospinal meningitis, in Appendix B, the pathogen of epidemic cerebrospinal meningitis
The relevant descriptions in the study, epidemiology and clinical manifestations are revised (see Appendix B).
This standard was drafted. China Center for Disease Control and Prevention, Beijing Ditan Hospital affiliated to Capital Medical University, Shandong Provincial Disease Prevention and Control
Center, Gansu Provincial Center for Disease Control and Prevention, Qilu Children's Hospital of Shandong University, Beijing Children's Hospital of Capital Medical University, Chinese Medicine
Beijing Union Medical College Hospital.
The main drafters of this standard. Li Yixing, Cui Fuqiang, Shao Zhujun, Li Junhong, Li Xingwang, Xu Aiqiang, Jiang Rongmeng, Zhu Bingqing, Li Hui,
Gaizhong Tao, Shen Kunling, Wu Dan, Fan Hongwei.
The previous versions of the standards replaced by this standard are as follows.
--WS 295-2008.
Diagnosis of epidemic cerebrospinal meningitis
1 Scope
This standard specifies the diagnostic basis, diagnostic principles, diagnosis and differential diagnosis of epidemic cerebrospinal meningitis.
This standard is applicable to the diagnosis of epidemic cerebrospinal meningitis at various levels of medical and health institutions and their medical staff.
2 Abbreviations
The following abbreviations apply to this document.
CFU/mL. colony forming unit per ml (colony-forming unit/mL)
DIC. disseminated or diffuse intravascular coagulation
DNA. deoxyribonucleic acid
ELISA. enzyme-linked immunosorbent assay
IgG. immunoglobulin G (immunoglobulin G)
OD. optical density
PBS. phosphate buffer saline
Real-time PCR. real-time polymerase chain reaction
SBA. serum bactericidal assays
TTC. triphenyl tetrazolium chloride
Rpm. revolutions per minute (revolutions per minute)
WHO. world health organization
3 diagnosis basis
3.1 Epidemiological history
Local occurrence or prevalence of the disease, or history of travel or travel in epidemic cerebrospinal meningitis within 10 days before onset.
3.2 Clinical manifestations
3.2.1 Incubation period
A few hours to 10 days, usually 2 days to 3 days.
3.2.2 Main clinical symptoms and signs
3.2.2.1 fever, headache, vomiting, and/or meningeal irritation, infants and young children can see the anterior hernia. Severe patients can have varying degrees
A disturbance of consciousness and/or infection with toxic shock.
3.2.2.2 Defects (spots) appear on the skin and mucous membranes. Freckles can be quickly expanded into pieces.
3.3 Laboratory testing
3.3.1 Blood routine
The total number of white blood cells and neutrophil counts were significantly increased.
3.3.2 Cerebrospinal fluid routine
The typical change is pressure increase, the appearance is turbid rice soup or pus; the number of white blood cells is significantly increased, and the polymorphonuclear leukocytes are mainly increased;
Sugar and chloride are significantly reduced and protein content is increased. However, in the early stage of the disease, only the pressure rises, the appearance is clear, and then a typical change occurs.
Cerebrospinal fluid in patients with cerebral shock is usually clear, and there is no change in protein, cell number and sugar.
3.3.3 Pathogens
3.3.3.1 Defects (plaque) tissue fluid, cerebrospinal fluid smear test, Gram-negative kidney-type diplococcus can be seen in polymorphonuclear leukocytes or outside the cells.
3.3.3.2 Cerebrospinal fluid, blood, sputum (plaque) tissue fluid culture Neisseria meningitidis positive.
3.3.3.3 cerebrospinal fluid, blood, sputum (plaque) tissue fluid Neisseria meningitidis specific nucleic acid detection positive.
3.3.4 Immunology
3.3.4.1 Acute cerebrospinal fluid samples were positive for Neisseria meningitidis-specific polysaccharide antigens.
3.3.4.2 In the recovery period, the serum specificity of Neisseria meningitidis IgG antibody is 4 or more times higher than that in the acute phase.
4 Diagnostic principles
Suspected cases and/or clinically diagnosed diseases based on epidemiological history and clinical manifestations and routine blood test results and/or cerebrospinal fluid findings
The diagnosis of the case.
Confirmation of Neisseria meningitidis pathogen or immunological test results, further pathogen clustering for cases with positive pathogen detection
Diagnosis (see A.3 in Appendix A).
5 diagnosis
5.1 suspected cases
It also complies with 3.1 and 3.2.2.1, and at the same time complies with any of 3.3.1 and 3.3.2.
5.2 Clinical diagnosis cases
Meets 5.1 and complies with 3.2.2.2.
5.3 confirmed cases
Meets 5.1 or 5.2 and complies with any of 3.3.3 and 3.3.4.
5.4 Clinical classification
Clinical classification diagnosis is performed on the basis of clinical diagnosis or confirmed diagnosis (see Appendix B, B.3).
6 differential diagnosis
It is mainly caused by meningitis caused by other bacteria, sepsis caused by other causes, and cyanosis caused by various causes. Infant
It should also be differentiated from diseases such as febrile seizures (see Appendix B, B.4).
7 other
7.1 Carrier
No clinical symptoms and signs, throat swab culture positive Neisseria meningitidis or N. meningitidis specific nucleic acid test positive.
7.2 Other meningococcal diseases
After human infection with Neisseria meningitidis, most of them are asymptomatic carriers. In the case of symptoms, the clinical disease spectrum is complex and diverse, in addition to causing brain
In addition to meningitis, it can also cause sepsis, pneumonia, and occasionally can cause diseases such as arthritis, myocarditis, pericarditis and endophthalmitis.
Appendix A
(normative appendix)
Neisseria meningitidis laboratory test method
A.1 Sample collection, processing and transportation
A.1.1 Sample collection and processing
A.1.1.1 Cerebrospinal fluid
Aseptically collect at least 2 mL of cerebrospinal fluid and send it to the microbiology laboratory immediately after collection. If conditions permit, it is recommended to vaccinate at the bedside.
Cerebrospinal fluid (0.1 mL ~ 0.5 mL) was inoculated on 5% sheep blood chocolate plate (hereinafter referred to as chocolate plate) or blood plate, after three-zone scribing
Send to the laboratory for cultivation.
After the laboratory receives the cerebrospinal fluid sample, it should be tested within 1 h. First put the sample into a sterile test tube, 2 000 rpm ~ 3 000
Centrifuge for 20 min at rpm and aspirate the supernatant. The supernatant can be used for the detection of Neisseria meningitidis specific antigen, or it can be placed at -20 °C.
Other tests are performed. The precipitate should be thoroughly shaken and mixed for culture and microscopic examination. If the cerebrospinal fluid sample is less than 1 mL, it will not be performed.
Centrifugation, direct plating culture and Gram stain microscopy.
A.1.1.2 Blood
For nucleic acid testing (eg Real-time PCR), aseptically remove.200 μL of cerebrospinal fluid sample before centrifugation, -20 ° C
Save below. Aseptically collect 5 mL to 10 mL of venous blood in the acute phase of the patient and immediately send it to the microbiology laboratory for processing and testing. build
Inoculate at the bedside, immediately inject a proper amount of blood (5 mL to 10 mL) into the blood culture bottle, or inoculate 0.5 mL of blood directly into the chocolate.
Tablet or blood plate. The remaining blood sample is used for Neisseria meningitidis specific nucleic acid detection or IgG antibody detection. Collecting patients with acute onset
And in the recovery period, double blood samples, serum were separated, and N. meningitidis-specific IgG antibodies were detected. Should not be used during blood sample collection
Anticoagulant.
It is recommended to collect 1 part of each blood sample at the same time before the anti-infective treatment, and a total of 2 blood samples are cultured. Newborns take 1 blood sample
Product.
A.1.1.3 Defects or freckles
Select fresh spots or ecchymoses on the patient's skin, first disinfect with iodophor, then wipe the iodophor with 70% alcohol until the alcohol is completely evaporated.
Use a sterile needle to break through, extrude the tissue fluid, directly draw the tissue fluid smear with the disinfected slide, Gram stain microscopy; then use a sterile cotton swab
The tissue fluid is inoculated on a chocolate plate or a blood plate, and the three-zone is streaked and sent to the laboratory for culture.
A.1.2 Delivery of samples
Neisseria meningitidis is sensitive to temperature, avoiding exposure of the sample to sunlight, high temperature or cold environment, and the temperature is too low or too high.
The pathogen is dead. When transporting samples or cultures, keep samples at 25 ° C ~ 35 ° C, can not be transported at low temperature (for detection of resistance
Except for samples of body and nucleic acid).
A.2 Neisseria meningitidis culture and microscopy
A.2.1 Cerebrospinal fluid sample culture
The pellet was aspirated with a sterile capillary or micropipette tip and directly inoculated onto a chocolate plate and/or blood plate with a three-zone scribing.
5% CO2 environment, 37 ° C, culture for 24 h to 72 h, daily inspection of bacterial growth, timely transfer of suspected colonies on the plate and
Identification.
A.2.2 Cerebrospinal fluid sample microscopy
Pipette 10 μL～20 μL of the sediment after centrifugation of the cerebrospinal fluid sample, drop it on the glass slide and spread it, and dry the slide in the biological safety cabinet.
Quickly pass the flame 3 times to fix the smear, taking care to avoid burning. Crystal violet staining for 1 min, rinse the slides with running water for 1 min to remove excess
Moisture; Gram iodine mordant for 1 min, rinse the slide with running water and dry; decolorize with 95% ethanol for 5 s to 10 s; counterstain with 20% dye solution
s ~ 30 s, or counterstained with phenol red for 10 s ~ 15 s, rinse the slide with running water and dry or dry. Microscopic observation of the stained smear, in bright
Under the lens and oil mirror, Neisseria meningitidis is located in or outside the polymorphonuclear leukocytes, which is Gram-negative and Renal-shaped.
A.2.3 Separation and culture of blood samples
After receiving the plate or blood culture bottle that has been inoculated with blood samples, the laboratory should immediately place it in an environment of 37 ° C and 5% CO 2 for 24 h.
72 h. If using a blood culture bottle, observe the growth of the bacteria daily, such as the growth of bacteria, aseptically take 0.5 mL to inoculate the chocolate.
Plate and/or blood plate.
A.2.4 Neisseria meningitidis colony morphology
Neisseria meningitidis can be grown on blood plates or chocolate plates. After culturing on the blood plate for 18 h to 20 h, it is round, smooth,
Wet, central bulge, clear border, gray colonies, no hemolysis, colony diameter up to 1 mm. Colonies growing on chocolate plates
Large colonies, colorless or gray, opaque.
A.2.5 Biochemical characteristics of Neisseria meningitidis
Identification of Neisseria meningitidis was performed using an oxidase assay and a glucose metabolism assay. If the oxidase test is positive, then the glucose metabolism test
Test. Neisseria meningitidis oxidizes glucose and maltose but does not oxidize lactose and sucrose.
A.3 Neisseria meningitidis serological grouping
A.3.1 Test method
Serogroup identification of Neisseria meningitidis can be performed by serum slide agglutination. At present, Neisseria meningitidis has identified 12 different
The serogroup, of which A, B, C, W, X, and Y are the six most common serogroups that cause epidemic cerebrospinal meningitis.
A.3.2 Experimental operation
Wipe a piece of glass with ethanol, divide the slide into multiple parts with a crayon or other marker, add at the bottom of each part
10 μL of sterile saline, pick a suitable amount of bacterial culture from a chocolate plate or blood plate with a sterile inoculating loop or needle, stick or toothpick.
The culture was made into a slightly emulsion-like suspension in physiological saline for testing. Add the selected serum 10 μL or 10 to the top of each section
μL saline or PBS. Mix the serum or saline with the respective bacterial suspension under light or black background, shake the slide 1
Min~2 min (time may vary depending on the serum producer).
In view of biosafety, WHO recommends the use of formalin-inactivated suspension of Neisseria meningitidis instead of a physiological saline suspension of live bacteria. Formalin is a kind of
Cancers should be handled with great care during storage and use, and should be performed in a biosafety cabinet.
A.3.3 Reading of experimental results
Serum-separable N. meningitidis should be agglutinated only with one type of serum, without agglutination with saline or PBS. If in physiology
Agglutination in saline or PBS, indicating that Neisseria meningitidis has self-coagulation, and is judged as self-coagulating bacteria; if there is no self-coagulation phenomenon, but with two or more
The serum is agglutinated and is judged to be a polycoa. It cannot be agglutinated with any serum or normal saline or PBS, and is judged to be non-coagulable;
All cases can be reported as "serum-inseparable Neisseria meningitidis".
A.4 Real-time PCR diagnosis of epidemic cerebrospinal meningitis
A.4.1 species-specific Real-time PCR detection
A.4.1.1 ctrA gene detection
Most Neisseria meningitidis contains the ctrA gene (capsular transport gene), and a few strains will delete the ctrA gene into non-segregable bacteria.
Strain. Invasive cases of Neisseria meningitidis are mostly caused by infection with capsules. When detecting samples of aseptic parts such as cerebrospinal fluid and blood,
Real-time PCR was performed using the ctrA gene as a target gene. The ctrA gene Real-time PCR primers and probe sequences are as follows.
ctrA-F. 5'-TGTGTTCCGCTATACGCCATT-3'
ctrA-R. 5'-GCCATATTCACACGATATACC-3'
ctrA-Pb. 5'-(FAM)AACCTTGAGCAA"T"CCATTTATCCTGACGTTCT (SpC6) -3'
The "T" marks the quenching group BHQ1.
A.4.1.2 sodC gene detection
Neisseria meningitidis contains sodC gene (copper-zinc superoxide dismutase gene), and other species of bacteria such as Haemophilus also include
There is a sodC gene. If you consider the non-segregable Neisseria meningitidis can also cause disease by accident, detect the sodC gene, its primers and probe sequences.
The columns are as follows.
sodC-F. 5'-GCACACTTAGGTGATTTACCTGCAT-3'
sodC-R. 5'-CCACCCGTGTGGATCATAATAGA-3'
sodC-Pb. 5'-(FAM)CATGATGGCACAGCAACAAATCCTGTTT(BHQ1)-3'
A.4.2 serogroup-specific Real-time PCR detection
A sample positive for ctrA or sodC gene can be judged to be Neisseria meningitidis infection, and serogroup-specific gene detection is required to determine
Neisseria meningitidis serogroup. The corresponding primers and probe sequences are shown in Table A.1.
Table A.1 Neisseria meningitidis serogroup identification Real-time PCR primers and probe sequences
Serogroup detection gene primer/probe sequence (5'-3')
A sacB
F. AAAATTCAATGGGTATATCACGAAGA
R.ATATGGTGCAAGCTGGTTTCAATAG
Pb.FAM-CTAAAAG"T"AGGAAGGGCACTTTGTGGCATAAT-SpC6
B synD
F.GCTACCCCATTTCAGATGATTTGT
R. ACCAGCCGAGGGTTTATTTCTAC
Pb.FAM-AAGAGATGGGYAACAAC"T"ATGTAATGTCTTTATTT-SpC6
C synE
F. CCCTGAGTATGCGAAAAAAATT
R.TGCTAATCCCGCCTGAATG
Pb.FAM-TTTCAATGC"T"AATGAATACCACCGTTTTTTTGC-SpC6
W synG
F. TATTTATGGAAGGCATGGTGTATG
R. TTGCCATTCCAGAAATATCACC
Pb.FAM-AAATA"T"GGAGCGAATGATTACAGTAACTATAATGAA-SpC6
X xcbB
F.TGTCCCCAACCGTTTATTGG
R. TGCTGCTATCATAGCCGCC
Pb. FAM-TGTTTGCCCACATGAATGGCGG-BHQ1
Y synF
F.TCCGAGCAGGAAATTTATGAGAATAC
R.TTGCTAAAATCATTCGCTCCATAT
Pb.FAM-TATGGTG"T"ACGATATCCCTATCCTTGCCTATAAT-SpC6
Note. The "T" marks the quenching group BHQ1.
A.4.3 DNA processing of clinical samples
Extraction of Neisseria meningitidis from clinical samples such as cerebrospinal fluid, blood, and sputum (plaque) tissue fluid using a commercially available DNA extraction kit
DNA, direct boiling is not recommended. Depending on the type and amount of clinical samples, and the likelihood of other Gram-positive infections,
When extracting the pre-treatment of clinical sample DNA, it is recommended to add lysozyme and lysozyme.
A.4.4 Real-time PCR reaction system and reaction conditions
The PCR reaction system is 20 μL, 10 μL of 2×PCR reaction mixture, 2 μL of upstream and downstream primers and probes (upstream primers of ctrA)
The final concentrations of the probes were 0.9 μmol/L, 0.9 μmol/L, and 0.1 μmol/L, respectively. The final concentrations of the sodC primers and probes were 0.3.
Μmol/L, 0.6 μmol/L, 0.1 μmol/L, the final concentration of the primers and probes were 0.6 μmol/L, 0.6 μmol/L, 0.1
Molmol/L), according to the requirements of the fluorescence PCR instrument to determine whether to add reference fluorescence Rox and the amount of addition, DNA template 2 μL, ultrapure water is added to
20 μL. Reaction conditions. annealing temperature 60 ° C, a total of 50 cycles; other reaction conditions according to the description of the 2 × PCR reaction mixture used
The book is adjusted.
A.4.5 Judging the results of Real-time PCR detection
The amplification plot should be a smooth S-shaped curve. If the shape of the curve changes, it should be judged as negative or retested. Manually dragging the threshold line
The Ct value was read after going up to the baseline, and the test results were judged according to the following criteria.
"Positive". Ct value ≤ 36; "negative". Ct value ≥ 40; "suspicious". Ct value between 36 and 40
The Ct value is between 36 and 40. The result is suspicious and should be retested. There are two ways to retest.
a) Repeat the test by diluting the template 4 to 10 times and replacing the 2 μL template with 4 μL. If the Ct value is ≤ 36, the
The sample was judged positive, otherwise it was negative.
b) Set up three parallel hole detections at the same time. If two or three holes have a good amplification curve, judge it as positive, otherwise
negative.
A.5 Identification of suspected strains by PCR
A.5.1 species specific identification
The crgA gene is present in all Neisseria meningitidis and has been used as a target gene for species specific identification of Neisseria meningitidis. But because of the part
L. lactis also has a highly homologous crgA gene with Neisseria meningitidis, and it is recommended to combine the detection results of the crgA gene and the sodC gene.
It was determined that N. meningitidis was determined when both gene detection results were positive at the same time. The sequence of the crgA and sodC primers is shown in Table A.2.
Table A.2 Identification of common PCR primer sequences for Neisseria meningitidis species
Detection of gene primer sequences (5'-3')
crgA
F.GCTGGCGCCGCTGGCAACAAAATTC
R. CTTCTGCAGATTGCGGCGTGCCGT
sodC
F. AGCACACGAGCATAATACGAT
R. TAACCATGTTGTTTTGCACCT
A.5.2 Identification of Neisseria meningitidis
The strains identified as Neisseria meningitidis can be identified by common PCR methods, and the corresponding primer sequences are shown in Table A.3.
Table A.3 Common N. meningitidis group identification of common PCR primer sequences
Serogroup detection gene primer sequence (5'-3')
A orf-2
F.CGCAATAGGTGTATATATTCTTCC
R. CGTAATAGTTTCGTATGCCTTCTT
B siaD
F. GGATCATTTCAGTGTTTTCCACCA
R. GCATGCTGGAGGAATAAGCATTAA
C siaD
F.TCAAATGAGTTTGCGAATAGAAGGT
R. CAATCACGATTTGCCCAATTGAC
Y siaD
F. CTCAAAGCGAAGGCTTTGGTTA
R. CTGAAGCGTTTTCATTATAATTGCTAA
W siaD
F.CAGAAAGTGAGGGATTTCCATA
R. CACAACCATTTTCATTATAGTTACTGT
X ctrA
F. GTCTTTGTATAAGGCCCAAG
R.TTGTCGCGGATTTGCAACTA
E ctrA F. ATTACGCTGACGGCATGTGGA
R.TTGTCGCGGATTTGCAACTA
Z ctrA
F.TATGCGGTGCTGTTCGCTATG
R.TTGTCGCGGATTTGCAACTA
A.5.3 Sample processing
The strain DNA can be extracted using a commercially available DNA extraction kit. Can also be directly boiled, prepared with appropriate amount of sterilized distilled water
The bacterial suspension was boiled in a boiling water bath for 10 min, centrifuged at 12 000 rpm for 5 min, and the supernatant was taken as a template for PCR amplification.
A.5.4 PCR amplification and product detection
Pre-denaturation at 94 ° C for 5 min; 94 ° C for 30 s, 55 ° C to 60 ° C for 30 s, 72 ° C for 40 s, 30 cycles; 72 ° C terminal extension for 5 min.
The reaction product was detected by 1.5% agarose gel electrophoresis at a voltage of 5 V/cm.
A.6 latex agglutination test
A.6.1 Sample processing and testing
It should be handled in strict accordance with the kit instructions. For best results, the supernatant of the cerebrospinal fluid sample should be tested as soon as possible;
The product can not be detected immediately, and should be stored in the short-term (4 h ~ 6 h) at 2 ° C ~ 8 ° C, or frozen at -20 ° C for a long time. Latex reagent is placed at 2 ° C ~ 8 ° C
Save, can not be frozen.
The procedure for detecting cerebrospinal fluid samples by latex agglutination test should follow the recommended method of the kit. The general steps are as follows.
a) Centrifuge cerebrospinal fluid sample at 1 000 × g for 10 min to 15 min, collect the supernatant, and precipitate for Gram staining and culture.
b) The supernatant was heated at 100 ° C for 3 min.
c) Mix the latex agglutination reagent.
d) Drip 1 drop of latex reagent onto the card or slide.
e) Add 30 μL to 50 μL of the supernatant to the latex.
f) It is best to shake slowly (100 rpm) on the oscillator; if unconditionally, shake it manually for 2 min to 10 min.
Note. Try to avoid cross contamination when mixing.
g) Observe the results of the agglutination test in bright places.
A.6.2 Judgment of results
Positive result. Aggregation of latex particles (or visible mass) within 2 min to 10 min.
Negative result. The suspension is still homogeneous and slightly cloudy (like milk).
A.7 enzyme-linked immunosorbent assay (ELISA)
ELISA can detect serum-specific IgG antibody levels in acute and convalescent patients. Strictly follow the instructions of the kit for inspection
Measurement.
A.8 Serum bactericidal test (SBA)
A.8.1 Target bacteria
Neisseria meningitidis as a target strain should be tolerant to the natural bactericidal action of complement, but sensitive to bactericidal antibody responses.
A.8.2 Preparation of diluent
Sterilized phosphate buffer (DPBS). containing 0.5 mmol/L MgCl2, 0.9 mmol/L CaCl2; pH 7.4. Formulated diluent
Packed in a vial and placed at 4 ° C for 2 weeks. Add 1 mL of 10% glucose per 100 mL of dilution before use.
A.8.3 Titration plate, complement and agar selection
The 96-well "U"-type bottom or "flat" bottom cell culture plates were selected for the titration plates. Complement is generally used for 3 weeks to 4 weeks of young rabbit serum, requiring no self
However, the target bacteria activity is killed, but a higher level of bactericidal antibody titer should be produced when a known positive reference serum is added. Agar using triphenyltetrazolium chloride
Agar medium (TTC agar).
A.8.4 Positive reference serum preparation
The diagnostic serum prepared by immunizing rabbits with Neisseria men...
Tips & Frequently Asked Questions:Question 1: How long will the true-PDF of WS 295-2019_English be delivered?Answer: Upon your order, we will start to translate WS 295-2019_English as soon as possible, and keep you informed of the progress. The lead time is typically 2 ~ 4 working days. The lengthier the document the longer the lead time. Question 2: Can I share the purchased PDF of WS 295-2019_English with my colleagues?Answer: Yes. The purchased PDF of WS 295-2019_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet. Question 3: Does the price include tax/VAT?Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countriesQuestion 4: Do you accept my currency other than USD?Answer: Yes. If you need your currency to be printed on the invoice, please write an email to [email protected]. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay. Question 5: Should I purchase the latest version WS 295-2019?Answer: Yes. Unless special scenarios such as technical constraints or academic study, you should always prioritize to purchase the latest version WS 295-2019 even if the enforcement date is in future. Complying with the latest version means that, by default, it also complies with all the earlier versions, technically.
|