HOME Cart(0) Quotation About-Us Policy PDFs Standard-List
www.ChineseStandard.net Database: 189760 (18 Oct 2025)

SN/T 4877.13-2019 English PDF

US$259.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
SN/T 4877.13-2019: DNA barcoding screening method - Part 13: Qurantine Potyviruses
Status: Valid

Standard ID	Contents [version]	USD	STEP2	[PDF] delivered in	Standard Title (Description)	Status	PDF
SN/T 4877.13-2019	English	259	Add to Cart	3 days [Need to translate]	DNA barcoding screening method - Part 13: Qurantine Potyviruses	Valid	SN/T 4877.13-2019

PDF similar to SN/T 4877.13-2019

Standard similar to SN/T 4877.13-2019

GBZ 57 GB/T 31989 SN/T 4877.15 SN/T 4877.14 SN/T 4877.12

Basic data

Standard ID	SN/T 4877.13-2019 (SN/T4877.13-2019)
Description (Translated English)	DNA barcoding screening method - Part 13: Qurantine Potyviruses
Sector / Industry	Commodity Inspection Standard (Recommended)
Classification of Chinese Standard	C62
Word Count Estimation	12,150
Date of Issue	2019-09-03
Date of Implementation	2020-03-01
Regulation (derived from)	Natural Resources Department Announcement No. 7 of 2019
Issuing agency(ies)	General Administration of Customs

SN/T 4877.13-2019: DNA barcoding screening method - Part 13: Qurantine Potyviruses

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Gene barcode screening methods-Part 13. Quaternary potato virus Y virus) ICS 65.020B16 People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard SN/T 478.13-2019 Genetic barcode screening method Part 13. Quarantine potato Y virus Published.2019-2009-03 2020-03-01 implementation Published by the General Administration of Customs of the People's Republic of China ????? ????, ????, ??

Foreword

This section is drafted in accordance with the rules given in GB/T 1.1-2009. Please note that some elements of this document may involve patents. Publication of this document The agency is not responsible for identifying these patents. This section is proposed and managed by the General Administration of Customs of the People's Republic of China. This section was drafted. Beijing Customs of the People's Republic of China, Qingdao Customs of the People's Republic of China. The main drafters of this section. Deng Congliang, Liu Xingliang, Zhang Lijie, Wang Yingchao, Zhao Xiaoli, Luo Weifeng, and Zheng Chunsheng. SN/T 478.13-2019 SN/T 4877 "Methods for Screening Gene Bar Codes" is divided into 15 parts. --Part 1. Quarantine Corynebacterium; --Part 2. Quarantine Xanthomonas; --Part 3. Quarantine phytoplasma; --Part 4. Phytophthora quarantine; --Part 5. Phytophthora quarantine; --Section 6. Quarantine Acidophilus; --Section 7. Quarantine Verticillium; --Part 8. Quarantine Anthrax; --Section 9. Quarantine --Part 10. Phytosanitary quarantine; --Part 11. Quarantine heterogeneous subgenus; --Part 12. Cucumber green mottle mosaic virus; --Part 13. Quarantine potato Y virus --Part 14. Quarantine Southern Bean Mosaic Virus; --Part 15. Quarantine leaf spot mold. This part is part 13 of SN/T 4877. ????? ????, ????, ?? Genetic barcode screening method Part 13. Quarantine potato Y virus

1 Scope

This section specifies the RNA extraction, gene amplification, and sequence analysis of quarantine potato prion virus gene barcode screening methods. Comparison analysis and result determination. This section applies to the screening of quarantine viruses in the potato prion genus in host plants.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this document. file. For undated references, the latest version (including all amendments) applies to this document. Sn/t 2122 quarantine sampling of inbound and outbound plants and plant products.

3 Terms and definitions

The following terms and definitions apply to this document. DNA barcode refers to a standard, sufficiently mutated, easily amplified, and relatively short DNA that can represent the species in the organism. Fragment.

4 Basic Information of Potato Y Virus

Chinese name. Potato Prion See Appendix A for details.

5 Method principle

Design and Synthesis of Degenerate Primers Based on Conserved Regions in the Genome Sequence of Potato Prion Virus Shape-code screening method; sequence determination of PCR products, and determination of virus types by sequence analysis. So potato prion Molecular biological characteristics are the main basis for the development of this detection and identification method. SN/T 487.7.13-201919 ????? ????, ????,?

6 equipment and reagents

6.1 Apparatus and equipment Grinding instrument, microbalance (sensibility. 0.01g), PCR instrument, electrophoresis instrument, horizontal electrophoresis tank, gel imager, high-speed refrigerated desktop centrifuge Machine, water bath or constant temperature incubator, pH meter, adjustable pipettes of various ranges (1000 μL,.200 μL, 100 μL, 20 μL, 10 μL, 2 μL), etc. 6.2 Reagents See Appendix B for reagents.

7 Screening and identification methods

7.1 Sampling inspection Sampling and sampling shall be carried out in accordance with the method given by Sn/T 2122. 7.2 RT-PCR method According to the method given in Appendix B, the general RT-PCR test is performed. Use known virus isolates as positive controls and healthy plant tissues as Negative control, and set a blank control. 7.3 Sequence determination and analysis After the PCR product is recovered, it can be cloned, sequenced, or directly sequenced (the sequence determination can be completed by a professional biological company) to make). The determined nucleotide sequence and translated amino acid sequence were compared with the known potato prion virus sequence (see Appendix C) Line comparison. Adjacent method (or NJ algorithm of MEGA6) is used to construct phylogenetic tree.

8 result judgment

8.1 If the test result of the RT-PCR method is negative, it is determined that no potato prion virus is detected. 8.2 If the result of the RT-PCR method is positive, perform sequence determination and analysis. a) If the translated amino acid sequence has the highest homology with the known amino acid sequence of the potato prion virus and is greater than 80%, then judge A potato prion virus was identified (specific virus types need to be identified by other methods). b) If the translated amino acid sequence has less than 80% homology with the known sequence of the potato prion virus. --- If phylogenetic analysis indicates clustering with the potato prion virus, a potato prion disease is determined to be detected Poison (specific virus types need to be further identified by other methods); Note. The detected virus may belong to a known virus whose genome sequence has not been determined or a new virus species that has not been reported. --- If phylogenetic analysis indicates that they are not clustered with the potato prion virus, it is determined that no potato prion virus has been detected Is a virus. c) If the determined genomic sequence is related to plant virus genes in PPV, PVA, PPV and BBRMV in the potato prion genus The group sequence has the highest homology, so it is determined to screen for quarantine plant virus. It needs to be developed according to the specific virus quarantine identification standard method. The line finally identified the species. SN/T 487.7.13-201919 ????? ????, ????,?

9 Results Record

Record sample information and test data, including sample source, plant species, sampling time and place, test time, method and results, and Signed by personnel. In RT-PCR gel electrophoresis detection, electrophoresis photos should be saved, and sequencing reports should be saved in the sequencing results. 10 sample preservation The samples of the potato prion genus should be properly stored in an ultra-low temperature refrigerator, or stored at low temperature after lyophilization, and registered and labeled. For review. SN/T 487.7.13-201919 ????? ????, ????,?

Appendix A

(Informative appendix) Potato Y Virus Basic Information A. Morphology of virion The virus particles of the potato prion gene are linear particles, usually about 680-900 nm in length, 12-15 nm in diameter, and a spiral symmetrical structure. The pitch is about 3.4nm. The viral coat protein of this genus is composed of a polypeptide with a molecular weight of 28-38 kDa, accounting for 95% of the total viral particles. (Figure A.1). Figure A. 1 Mitochondrial structure of potato Y virus (Http. //viral_one.expas.org/al_by_spices/50.html) A. 2 Virus genome structure and function The potato prion virus is a single-split positive single-stranded RNA virus with a total length of about 10 Kb, covalently linked at the 5 ′ end of the RNA genome. Take a protein, called VPg (viral protein, genome-linked), about 24kDa, with a polly (A) tail at the 3 ′ end, 5 ′ and 3 ′ There is an untranslated region (UTR) at each end; the first open reading frame of the entire genome encodes a large polyprotein. It is processed into proteins with different functions. The processed mature proteins from N-terminus to C-terminus are. P1 protein, HC-Proo protein, P3 protein, 6K1 protein, CI protein, 6K2 protein, VPg protein, Nia protein, Nib protein and coat protein CP (Hari, 1981; Dougherty Carrington, 1988; Murphytal. ,.1995). Three of the viral genomes encode proteins (P1, HC-Pro and Nia proteins) are proteases with the ability to cleave and cleave other proteins, and their cleavage sites have a certain specificity (Dougherty Semiller,.1993). Recent research shows that the potato prion family virus also encodes a short open reading frame, located at P3 (Chungetal.,.2008). The structural features of the potato prion gene are shown in Figure A. 2. Figure A. 2 Genomic structural characteristics of the potato Y virus (sources are the same as Figure A.1) SN/T 487.7.13-201919 ????? ????, ????,? A. 3 Some virus types of potato Y virus See Table A for some virus types of the potato prion genus. 1. Table A. 1 Some virus types of the potato Y virus genus Number Chinese Name Scientific Name SN/T 487.7.13-201919 ????? ????, ????,? Number Chinese Name Scientific Name SN/T 487.7.13-201919 ????? ????, ????,?

Appendix B

(Normative appendix) Universal RT-PCR detection method B. 1 main reagents B. 1.1 RNA extraction reagents Double-distilled water treated with TRIZolagent, chloroform, isopropanol, 70% ethanol, and diethyl pyrocarbonate (DEPC). B. 1.2 RT-PCR reagents 5 × RT buffer, dNTP mixed solution (10 mmol/L each), M-Mulv reverse transcriptase (200U/μL), RNA enzyme inhibitor (40U/μL), 10 × PCR buffer (containing 20 mmol/L Mg2 +), TQDNA polymerase (2.5U/μL). Tris base 108g 55g boric acid Na4EDA 9.3g was dissolved with double distilled water, and the volume was adjusted to 1L. B. 1.4 Electrophoresis reagent Agarose, 0.5 μg/μL ethidium bromide solution, 10 × TBE buffer. B. 2 Primer sequence and synthesis --- If the test sample does not show a band the same size as the positive control, the PCR test result is negative. SN/T 487.7.13-201919 ????? ????, ????,?

Appendix C

(Informative appendix) Quarantine potato Y virus gene reference sequence ＞ Plumpoxvirus (NC_0014445.1) ATTGGTTTGTGTGTCGATAGAGAGATAGGAATAGCGATCCTCCCCCAGATATCACATTGATAGTGTGTGGTAGTGTG GATGGGGGAAAACACAGTGTGAGTGATCGTCATCAAGACGCATGTGTTGTGATCGCTAGCGACAACCCCCT TTTAGACACAAAATTAGTGCACACATTTCTCATAGTACGGTCGCTGTAGAGGTCGATTATGATGAAAAACAAatt TATGAAAAAGACGATACCATCGTCCATGAGTGATAGTCATCGAGCGTCACAGCTACAGCTACGCACTCCC GCCAGAATATTGCCCTTTGTATTTTTCTATCGATCACTCTCAACCACCCCCGCTGCGCGCGGCCGTGAGAG CTCACATACCAAATGAGAGCGAGCGCA ＞ Banananbractomosaicvirus (NC_007745.1) ATTGGTTGTGTGTGCATAGAGAGAGATAGGAGCATCATCACCACAATATGTAACATGGTAGCATAGTGATTAGTG GACAAGGGTGTAGAGCACATAGGTCTATACAGCTCCATCTATTAGTGACAGCTCTAGCTCTCTTT TTCGCGCAAAATGTAGCGCACATTTTTTTCTGTAGTCGCCGGTCGAGCGCATCACATAACATAGCTCGATTATG TCCGCGAGAGATATATCGTCCTAGGTGTGGGAGCGCTCTAGAGGTAGTGATTAGCATATCGATTAG CCCCATATGCGATTTGTATTTTTCTATCGATCATCATCACTAACACATAGACCGAGCGCTAGAGAGAG CACACACGCGAGATGAGAAGGTCGAGGT ＞ PotatovirusA (NC_040403.1)

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of SN/T 4877.13-2019_English be delivered?

Answer: Upon your order, we will start to translate SN/T 4877.13-2019_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of SN/T 4877.13-2019_English with my colleagues?

Answer: Yes. The purchased PDF of SN/T 4877.13-2019_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to [email protected]. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.