HOME   Cart(0)   Quotation   About-Us Policy PDFs Standard-List
www.ChineseStandard.net Database: 189759 (19 Oct 2025)

SN/T 4876.7-2019 English PDF

US$259.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
SN/T 4876.7-2019: (DNA barcode method Part 7: Poinsettia subgenus)
Status: Valid
Standard IDContents [version]USDSTEP2[PDF] delivered inStandard Title (Description)StatusPDF
SN/T 4876.7-2019English259 Add to Cart 3 days [Need to translate] (DNA barcode method Part 7: Poinsettia subgenus) Valid SN/T 4876.7-2019

PDF similar to SN/T 4876.7-2019


Standard similar to SN/T 4876.7-2019

NY/T 2288   SN/T 3075   JB 2293   SN/T 4876.9   SN/T 4876.8   SN/T 4876.6   

Basic data

Standard ID SN/T 4876.7-2019 (SN/T4876.7-2019)
Description (Translated English) (DNA barcode method Part 7: Poinsettia subgenus)
Sector / Industry Commodity Inspection Standard (Recommended)
Classification of Chinese Standard B16
Word Count Estimation 12,159
Date of Issue 2019-09-03
Date of Implementation 2020-03-01
Regulation (derived from) Natural Resources Department Announcement No. 7 of 2019
Issuing agency(ies) General Administration of Customs

SN/T 4876.7-2019: (DNA barcode method Part 7: Poinsettia subgenus)

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(DNA barcode method Part 7. Poinsettia subgenus) ICS 65.002.01B16 People's Republic of China Entry-Exit Inspection and Quarantine Industry Standard SN/T 487.67-2019 DNA Barcoding Methods Part 7. Subgenus Poinsettia Published.2019-2009-03 2020-03-01 implementation Published by the General Administration of Customs of the People's Republic of China ????? ????, ????, ??

Foreword

This section is drafted in accordance with the rules given in GB/T 1.1-2009. Please note that some elements of this document may involve patents. Publication of this document The agency is not responsible for identifying these patents. This section is proposed and managed by the General Administration of Customs of the People's Republic of China. This section was drafted. Ningbo Institute of Inspection and Quarantine Science and Technology, Nanjing Customs, People's Republic of China Xin, Animal and Plant and Food Inspection and Quarantine Technology Center of Shanghai Customs, People's Republic of China, Guangzhou Customs, People's Republic of China, China Inspection and Quarantine Institute of Epidemiology, Fuzhou Customs, People's Republic of China, Qingdao Customs, People's Republic of China. The drafters of this section. Xu Ying, Fu Jianguo, Yin Liping, Zhang Jihong, Zhang Huili, Fu Yining, Wu Hairong, Fan Xiaohong, Yu Wentao, Song Tao. SN/T 487.67-2019 SN/T 4876 "DNA Barcoding Method" is divided into 7 parts. --Part 1. Quarantine milk termites; --Part 2. Quarantine broken eye Monochamus; --Part 3. Quarantine volume moth; --Part 4. Quarantine Sorghum --Part 5. Datura; --Part 6. Pleurotus --Part 7. Poinsettia subgenus. This section is part 7 of SN/T 4876. ????? ????, ????, ?? DNA Barcoding Methods Part 7. Subgenus Poinsettia

1 Scope

This section specifies the DNA barcode detection method for common species of Euphorbia poinsettia subgenus. This section applies to the determination, comparison analysis and judgment of DNA barcodes of common species of Euphorbia poinsettia subgenus.

2 Normative references

The following documents are essential for the application of this document. For dated references, only the dated version applies to this document. file. For undated references, the latest version (including all amendments) applies to this document. GB/T 3214 quarantine identification method

3 Terms and definitions

The following terms and definitions apply to this document. 3.1 DNA barcodes are short, standardized fragments of genes used to distinguish between different species. This fragment has obvious legacy among species Mutation and differentiation and easy PCR amplification. 3.2 The sequence of the sequence from 5 'to 3' is as follows. external transcription spacer (ETS), 18S gene, internal transcription Spacer 1 (ITS1), 5.8S gene, internally transcribed spacer 2 (ITS2), 28S gene, and intergenic sequence spark, IGS). The 18S, 5.8S, and 28S genomic sequences in ribosomal RNA tend to be conserved in most organisms, and Change is small, while the internal transcription spacers ITS1 and ITS2 are non-coding regions, they have less selection pressure, relatively large changes, and Enough to provide the heritable traits required for a detailed systematic analysis. The amplified region selected by this standard includes 5.8S partial sequence, ITS2 The full sequence and the 28S partial sequence were amplified with a total length of about 449 bp, of which the length of the tooth split ETS2 was 219 bp. 3.3 Chloroplast NADH dehydrogenase complex F subunit gene ChloroplastNADhyderogensingsubunitF, position In the small single copy region of the chloroplast genome, it is located at the end of the hydrophobic arm of the thylakoid NDH complex. Hypothetical chloroplast NADH 727bp.

4 Basic Information of the Subgenus Poinsettia

Euphorbia is one of the most genus in the angiosperms, with about 2,000 species, which are found all over the world, among which Africa and Central and South America are more common. SN/T 4876.7--2019 ????? ????, ????,? Mayfield (1997) classified the Euphorbia poinsettia subgenus. There are about 24 species of this subgenus in the world. Halberd, David Euphorbia and Orangutan are harmful weeds, and poinsettia and orangutan are garden plants. See GB/T 3214 for detailed information.

5 Method principle

Identification.

6 equipment and main reagents

6.1 Apparatus and equipment PCR instrument, electronic balance (sensibility. 0.01g), freeze-mix mill, electrophoresis instrument, gel imaging system, high-speed refrigerated centrifuge, dissection Mirror, vortex shaker, refrigerator, water bath, sequencer, autoclave, adjustable micropipette (2 μL, 10 μL, 20 μL, 100 μL, 200 μL, 1000 μL) and corresponding tips, centrifuge tubes, PCR tubes, etc. 6.2 Main reagents Unless otherwise specified, all reagents are analytical grade or biochemical reagents. Plant Genome Extraction Kit, Ultrapure Water, DNA Marker, Agarose, Nucleic Acid Gel Dye, Liquid Nitrogen, Deoxyribonucleoside Triphosphate (DNTPs), Ta enzyme, 10 × PCR buffer, 10 × loading buffer, 50 × TAE buffer, primers (see Appendix B.1). CTAB method Extraction reagents (see Appendix A.1).

7 Screening and identification methods

7.1 Processing of samples See GB/T 3142 for sample identification. Plant material that needs to be extracted from DNA (1-2 seeds, silica gel dried leaves are 10mg), put into a 2mL round bottom centrifuge tube, add 2 steel balls to each tube, add liquid nitrogen and grind for 3min using a frozen mixing mill (30 times/second). 7.2 DNA preparation Total plant DNA was extracted using a commercial plant genome extraction kit or a modified CTAB method. improved Refer to Appendix A for the CTB method. 2. 7.3 DNA barcode gene fragment amplification See Appendix B for conditions. 7.4 Detection of PCR products SN/T 4876.7--2019 ????? ????, ????,? 7.5 Sequencing and Sequence Processing 45 μL of the remaining PCR amplification product was taken and separated by 1.5% agarose gel electrophoresis. The target fragment was purified using DNA product purification kit and sequenced. Sequencing primers are the same as PCR amplification primers. Sequencing results were edited using sequence splicing software, peak maps were compared, sequence directions were determined, sequencing primer sequences were removed, and sequencing was performed at both ends Sequences with mass Q value < 20 are removed.

8 result judgment

8.1 Determination of China's quarantine pest DNA barcode identification system To enter the species identification page. After entering the FASTA format (or plain text format) sequence in the identification box, click "Submit Evaluation", the system After BLAST, the identification result is automatically generated (see Appendix C). When the 10 most similar sequences are the same species, the maximum similarity Supplemented by other identification methods. 8.2 Determination of plant pest quarantine and identification system The query sequence was analyzed and compared, and the species that met the identification characteristics of this group and had a similarity of 100% was determined to be the unknown species. ITS2 and Please refer to Appendix D for the operation method of “physical and biological quarantine identification system”. 8.3 Determination of International General Database Log in to the GenBank database BLAST authentication system (http.//blast.ncbi.nlm.nih.gov/Blast.cgi) to the obtained ITS2 The species. See Appendix E for the gene sequence information of Euphorbia dentata and common approximate species.

9 Specimen and original data preservation

9.1 Specimen preservation Store plant tissues or DNAs that are ultimately identified as quarantine target species at -20 ° C. And indicate the source, host, and collection The time, place and collector shall be kept for one year for re-inspection. If a trade dispute is involved, it shall be kept until the dispute is resolved. 9.2 Raw data preservation After the sample is tested, its original record (including DNA sequence and sequencing peaks) and the inspection report must be archived to ensure proper protection. Management for re-inspection, negotiation and arbitration. SN/T 4876.7--2019 ????? ????, ????,?

Appendix A

(Informative appendix) DNA extraction method (improved CTAB method) A. 1 reagent A. 1.1 CTAB Extraction Solution CTAB 20g/L, sodium chloride 1.4mol/L, Tris0.1mol/L (pH8.0), EDTA0.02mol/L (pH8.0), autoclaving spare. A. 1.2 TE buffer (pH 8.0) Add 1mol/L Tris-HCL (pH8.0) 10mL and 0.5mol/LEDA (pH8.0) solution 2mL, add water to volume to 1000mL. Sterilize for 20 min at 103.5 kPa (121 ° C). A. 1.3 Trichloromethane. isoamyl alcohol solution Trichloromethane and isoamyl alcohol were mixed in a volume ratio of 24. 1. A. 1.4 Isopropanol. A. 1.5 70% ethanol (volume fraction). A. 2 Extraction steps Add 600 μL of CATAB extract, which has been preheated to 65 ° C, into a 2ml centrifuge tube containing plant powder and mix thoroughly with shaking; 30 minutes at 65 ° C, mix by inverting from time to time; centrifuge at 10,000 r/min for 5 minutes, and take the supernatant... Isoamyl alcohol (V. V = 24. 1) Extract once; take the supernatant, add an equal volume of isopropanol, and precipitate for more than 10 min at 4 ° C, then centrifuge at 2,000 r/min for 10 min and discard. Wash with 70% ethanol 1 or 2 times. After drying, add 50 μL TE buffer to dissolve the precipitate and store it in a refrigerator at –20 ° C until it is frozen. SN/T 4876.7--2019 ????? ????, ????,?

Appendix B

(Normative appendix) B. 1 Primer sequence The primer sequences are shown in Table B. 1. Table B. 1 Primer sequence Target gene primer sequence amplified fragment size (bp) ITS2 ITS3PITS3R GCATTCCGATGAGAGACGAGCG GACCGCTCTCTCACGACCATAAT Approx. 450 bp Ttgtatactatagtgttagtag CGAAAACATATATAAAATAGCGGTTAAA Approx. 770 bpp B. 2 PCR reaction system and parameters The PCR reaction system and parameters are shown in Table B. 2. Table B. 2 PCR reaction system and parameters Ingredient stock solution concentration 50μL reaction system loading volume (μL) dNTP mixture 2.5 mmol/L 4.0 10 × PCR buffer (with Mg2 +)-5.0 Forward primer 10 pmol/μL 2.0 Reverse primer 10 pmol/μL 2.0 Tazyme 5U/μL 0.5 DNA template 0.3ug/μL ～ 6ug/μL 2.0 ddH2O-34.5 Note. This primer is a universal primer. Each PCR reaction must be blanked to confirm whether it is contaminated. Commercialized PCRPremix is available. B. 3 PCR program of ITS2 gene The PCR reaction procedure of ITS2 gene is shown in Table B. 3. SN/T 4876.7--2019 ????? ????, ????,? Table B. 3 PCR program of ITS2 gene Step reaction temperature (℃) Number of time cycles Pre-denaturing 94 5min- transsexual annealing extend 30s 30s 45s Extension 72 10min- Step reaction temperature (℃) Number of time cycles Pre-denaturing 94 5min- transsexual annealing extend 45s 1min 45s Extension 72 10min- SN/T 4876.7--2019 ????? ????, ????,?

Appendix C

(Informative appendix) Operation method of quarantine pest DNA barcode identification system in China The operation method of China's quarantine pest DNA barcode identification system is shown in Figure C. 1 ～ C. 2. Figure C. 1 Species identification page Figure C. ２ Identification results page SN/T 4876.7--2019 ????? ????, ????,?

Appendix D

(Informative appendix) Gene barcode analysis software operation method Paste the query sequence in the "Enter aligned sequences" window. Click "Compare", the software will compare in the database range, and output the species identification results. fruit. The corresponding classification order of the barcode sequence with the highest similarity in the result is the classification order to which the query sequence belongs. In "More Match Results", click Click "Start Comparison" to determine the species that meets the identification characteristics of this group and has a similarity of 100% as the unknown species. "The result is shown in Figure D.1. The corresponding bar code sequence with the highest similarity is Euphorbia, with a similarity of 100%. Click" On "in this column. The sequence is that species. SN/T 4876.7--2019 ????? ????, ????,?

Appendix E

(Informative appendix) Sequence of common species of Poinsettia E. 1 Sequence information of common species of Poinsettia The sequence information of common species of Poinsettia is shown in Table E. 1. E. 1 Sequence information of common species of Poinsettia SN/T 4876.7--2019 ????? ????, ????,?

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of SN/T 4876.7-2019_English be delivered?

Answer: Upon your order, we will start to translate SN/T 4876.7-2019_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of SN/T 4876.7-2019_English with my colleagues?

Answer: Yes. The purchased PDF of SN/T 4876.7-2019_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to [email protected]. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.