HOME   Cart(0)   Quotation   About-Us Policy PDFs Standard-List
www.ChineseStandard.net Database: 189759 (19 Oct 2025)

SN/T 3984-2014 English PDF

US$289.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
SN/T 3984-2014: Quarantine protocol for canine parvovirus by real-time PCR
Status: Valid
Standard IDContents [version]USDSTEP2[PDF] delivered inStandard Title (Description)StatusPDF
SN/T 3984-2014English289 Add to Cart 3 days [Need to translate] Quarantine protocol for canine parvovirus by real-time PCR Valid SN/T 3984-2014

PDF similar to SN/T 3984-2014


Standard similar to SN/T 3984-2014

GB/T 20365   SN/T 1353   NY/T 909   SN/T 3986   SN/T 3987   SN/T 3985   

Basic data

Standard ID SN/T 3984-2014 (SN/T3984-2014)
Description (Translated English) Quarantine protocol for canine parvovirus by real-time PCR
Sector / Industry Commodity Inspection Standard (Recommended)
Classification of Chinese Standard B41
Classification of International Standard 11.220
Word Count Estimation 11,122
Date of Issue 12/1/2014
Date of Implementation 5/1/2015
Quoted Standard GB/T 6682; SN/T 2123
Regulation (derived from) State-Quality-Inspection-accreditation [2014] 614
Issuing agency(ies) General Administration of Customs
Summary This standard specifies the technical requirements of canine parvovirus real-time PCR detection method. This standard applies to the detection of canine parvovirus in susceptible animals.

SN/T 3984-2014: Quarantine protocol for canine parvovirus by real-time PCR

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Canine parvovirus real-time PCR and Quarantine Technical Specifications) People's Republic of China Entry-Exit Inspection and Quarantine Standards Canine parvovirus real-time PCR and Quarantine Technical Specifications Issued on. 2014-11-19 2015-05-01 implementation People's Republic of China The State Administration of Quality Supervision, Inspection and Quarantine released

Foreword

This standard was drafted in accordance with GB/T 1.1-2009 given rules. This standard is proposed and managed by the National Certification and Accreditation Administration Committee. This standard was drafted. People's Republic of China Sichuan Exit Inspection and Quarantine, Southwest University for Nationalities. The main drafters of this standard. Chen world, Yang Miao, Lin Hua, Hu Juan, Yang Xiaonong, Zhang Huanrong, Yangfa Long, Xue Changhua, to learn Hui, Mu Jing, Wang Bin, Yellow, Yu Hua. Canine parvovirus real-time PCR and Quarantine Technical Specifications

1 Scope

This standard specifies the technical requirements of canine parvovirus real-time PCR detection method. This standard applies to the detection of canine parvovirus in susceptible animals.

2 Normative references

The following documents for the application of this document is essential. For dated references, only the dated version suitable for use herein Member. For undated references, the latest edition (including any amendments) applies to this document. Laboratory use specifications and test methods GB/T 6682 Analysis SN/T 2123 Entry and Exit Animal Quarantine experimental sample collection, transport and storage specifications

3 instruments and reagents

3.1 The main instruments 3.1.1 quantitative PCR instrument. 3.1.2 High-speed refrigerated centrifuge. 3.1.3 vortex shaker. 3.1.4 thermostatic circulating water bath. 3.1.5 cryogenic refrigerator. 3.1.6 Single-head adjustable micropipette. 3.2 Reagents Reagents were analytical grade or biochemical reagents for real-time PCR reagents are contaminated with DNA-free enzyme dispensing container. All tests Ultra-pure water are sterilized, should be consistent with GB/T 6682 in tertiary water requirements. 3.2.1 animal fecal DNA extraction kit. 3.2.2 Animal blood and tissue DNA extraction kit. 3.2.3 Quantitative PCR reaction mix. 3.2.4 canine parvovirus positive plasmids, DNA sequences GGCCTGGGAACAGTCTTGACCAAGGAGAACCAACT AACCCTTCTGACGCCGCTGCAAAAGAACACGACGAAGCTTACGCTGCTTATCTTCGC. Sequences of the primers and probes 3.2.5 real-time PCR amplification used in Table 1. Table 1 Primers and TaqMan probes Primer and probe sequence length/bp Tm value/℃ GC /% Upstream primer 5'-GGCCTGGGAACAGTCTTGAC-3 '20 55.9 60.0 Downstream primer 5'-GCGAAGATAAGCAGCGTAAGC-3 '21 54.4 52.4 Taqman probe 5'-FAM-CCAACTAACCCTTCTGACGCCGCTG-TAMRA-3 '25 62.6 60.0

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of SN/T 3984-2014_English be delivered?

Answer: Upon your order, we will start to translate SN/T 3984-2014_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of SN/T 3984-2014_English with my colleagues?

Answer: Yes. The purchased PDF of SN/T 3984-2014_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to [email protected]. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.