| Standard ID | Contents [version] | USD | STEP2 | [PDF] delivered in | Standard Title (Description) | Status | PDF |
| SN/T 1166.3-2006 | English | 399 |
Add to Cart
|
3 days [Need to translate]
|
Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus
| Obsolete |
SN/T 1166.3-2006
|
PDF similar to SN/T 1166.3-2006
Basic data | Standard ID | SN/T 1166.3-2006 (SN/T1166.3-2006) | | Description (Translated English) | Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus | | Sector / Industry | Commodity Inspection Standard (Recommended) | | Classification of Chinese Standard | B41 | | Classification of International Standard | 11.220 | | Word Count Estimation | 10,112 | | Date of Issue | 2006-01-26 | | Date of Implementation | 2006-08-16 | | Quoted Standard | GB/T 6682 | | Regulation (derived from) | ?Industry Standard Announcement 2006 No.4 (Total No.76); National-Quality-Inspection-accreditation (2010) 582 | | Issuing agency(ies) | General Administration of Customs | | Summary | This standard specifies the vesicular stomatitis virus type New Jersey (NJ) and Indiana -based (IND) for the qualitative RT-PCR detection methods and stereotypes. | SN/T 1166.3-2006: Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus
Book of the People's Republic of China Entry and Exit Inspection and Quarantine
Blisters stomatitis reverse transcriptase polymerase chain reaction protocol
Released on.2006-01-26
Implementation of.2006-08-16
People's Republic
The General Administration of Quality Supervision, Inspection and Quarantine issued
Foreword
SN/T 1166 is divided into three parts.
--- blister stomatitis complement binding test procedures;
--- vesicular stomatitis micro serum neutralization test procedures;
--- vesicular stomatitis reverse transcriptase polymerase chain reaction protocol.
This part is the third part of SN/T 1166.
Appendix A of this part is a normative appendix, and Appendix B is an informative appendix.
This part is proposed and managed by the National Certification and Accreditation Administration.
This section drafted by. Yunnan Entry-Exit Inspection and Quarantine Bureau of the People's Republic of China.
The main drafters of this section. Hua Qunyi, Zhou Xiaoli, Xu Zizhong, Dong Jun, Yang Yunqing, Long Zhongbao.
This section is the first industry standard for entry-exit inspection and quarantine.
Blisters stomatitis reverse transcriptase polymerase chain reaction protocol
1 Scope
This part of SN/T 1166 specifies the RT-PCR characterization of the vesicular stomatitis virus New Jersey (NJ) and Indiana (IND).
And stereotype detection methods.
This section applies to the identification of vesicular stomatitis virus and epidemiological investigation, diagnosis, quarantine and monitoring of this disease.
2 Normative references
The provisions in the following documents become the provisions of this part by reference to this part of SN/T 1166. Quotations with dated
, all subsequent amendments (not including errata content) or revisions do not apply to this section, however, encouragement is achieved under this section
The parties to the agreement study whether the latest versions of these documents can be used. For undated references, the latest edition applies to this
section.
GB/T 6682 Analytical laboratory water specifications and test methods
3 reagents and materials
3.1 Water
Should meet the specifications of the first grade water in GB/T 6682.
3.2 Reagent purity
All chemical reagents were of analytical grade.
3.3 vesicular stomatitis virus standard strain
New Jersey-type (NJ) and Indiana-type (IND) standard strains, provided by designated units.
3.4 T犪狇 enzyme
Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature.
3.5 reverse transcriptase AM犞
Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature.
Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature.
Containing 10 mmol/L each of dCTP, dGTP, dATP, and dTTP.
3.8 Primers
3.8.1 In this test, the more conserved sequence of the vesicular stomatitis virus L protein gene was used as the PCR amplification region. Semi-sleeve RT-PCR
In the method, the half-set primers were designed according to the base differences of the amplified regions of the NJ strain and the IND strain, respectively.
Lateral primer I (P1). 5'AAGGCTCTCTGTTTCCGGATCTGG3'
Outer Primer II (P2). 5'TGATTCAATATAATTATTTTGGGAC3'
NJ half-set primer (P3). 5'TGTTCTGGTGTGCAAACCAGGTATC3'
IND half set primer (P4). 5'AGTAGAACTGTGCAAGCCCGGTATC3'
3.8.2 The primers were formulated to a concentration of 25 pmol/μL with DEPC water.
3.9 isoamyl alcohol
Pre-cool to -20 °C before use.
|