Path:
Home >
SN/T >
Page63 > SN/T 3984-2014
Price & Delivery
US$289.00 · In stock · Download in 9 secondsSN/T 3984-2014: Quarantine protocol for canine parvovirus by real-time PCR
Delivery: 9 seconds. True-PDF full-copy in English & invoice will be downloaded + auto-delivered via email. See
step-by-step procedureStatus: Valid
| Std ID | Version | USD | Buy | Deliver [PDF] in | Title (Description) |
| SN/T 3984-2014 | English | 289 |
Add to Cart
|
3 days [Need to translate]
|
Quarantine protocol for canine parvovirus by real-time PCR
|
Click to Preview a similar PDF
Basic data
| Standard ID | SN/T 3984-2014 (SN/T3984-2014) |
| Description (Translated English) | Quarantine protocol for canine parvovirus by real-time PCR |
| Sector / Industry | Commodity Inspection Standard (Recommended) |
| Classification of Chinese Standard | B41 |
| Classification of International Standard | 11.220 |
| Word Count Estimation | 11,128 |
| Date of Issue | 12/1/2014 |
| Date of Implementation | 5/1/2015 |
| Quoted Standard | GB/T 6682; SN/T 2123 |
| Regulation (derived from) | State-Quality-Inspection-accreditation [2014] 614 |
| Issuing agency(ies) | General Administration of Customs |
| Summary | This standard specifies the technical requirements of canine parvovirus real-time PCR detection method. This standard applies to the detection of canine parvovirus in susceptible animals. |
SN/T 3984-2014: Quarantine protocol for canine parvovirus by real-time PCR
---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
(Canine parvovirus real-time PCR and Quarantine Technical Specifications)
People's Republic of China Entry-Exit Inspection and Quarantine Standards
Canine parvovirus real-time PCR and Quarantine Technical Specifications
Issued on. 2014-11-19
2015-05-01 implementation
People's Republic of China
The State Administration of Quality Supervision, Inspection and Quarantine released
Foreword
This standard was drafted in accordance with GB/T 1.1-2009 given rules.
This standard is proposed and managed by the National Certification and Accreditation Administration Committee.
This standard was drafted. People's Republic of China Sichuan Exit Inspection and Quarantine, Southwest University for Nationalities.
The main drafters of this standard. Chen world, Yang Miao, Lin Hua, Hu Juan, Yang Xiaonong, Zhang Huanrong, Yangfa Long, Xue Changhua, to learn Hui, Mu Jing, Wang Bin,
Yellow, Yu Hua.
Canine parvovirus real-time PCR and Quarantine Technical Specifications
1 Scope
This standard specifies the technical requirements of canine parvovirus real-time PCR detection method.
This standard applies to the detection of canine parvovirus in susceptible animals.
2 Normative references
The following documents for the application of this document is essential. For dated references, only the dated version suitable for use herein
Member. For undated references, the latest edition (including any amendments) applies to this document.
Laboratory use specifications and test methods GB/T 6682 Analysis
SN/T 2123 Entry and Exit Animal Quarantine experimental sample collection, transport and storage specifications
3 instruments and reagents
3.1 The main instruments
3.1.1 quantitative PCR instrument.
3.1.2 High-speed refrigerated centrifuge.
3.1.3 vortex shaker.
3.1.4 thermostatic circulating water bath.
3.1.5 cryogenic refrigerator.
3.1.6 Single-head adjustable micropipette.
3.2 Reagents
Reagents were analytical grade or biochemical reagents for real-time PCR reagents are contaminated with DNA-free enzyme dispensing container. All tests
Ultra-pure water are sterilized, should be consistent with GB/T 6682 in tertiary water requirements.
3.2.1 animal fecal DNA extraction kit.
3.2.2 Animal blood and tissue DNA extraction kit.
3.2.3 Quantitative PCR reaction mix.
3.2.4 canine parvovirus positive plasmids, DNA sequences GGCCTGGGAACAGTCTTGACCAAGGAGAACCAACT
AACCCTTCTGACGCCGCTGCAAAAGAACACGACGAAGCTTACGCTGCTTATCTTCGC.
Sequences of the primers and probes 3.2.5 real-time PCR amplification used in Table 1.
Table 1 Primers and TaqMan probes
Primer and probe sequence length/bp Tm value/℃ GC /%
Upstream primer 5'-GGCCTGGGAACAGTCTTGAC-3 '20 55.9 60.0
Downstream primer 5'-GCGAAGATAAGCAGCGTAAGC-3 '21 54.4 52.4
Taqman probe 5'-FAM-CCAACTAACCCTTCTGACGCCGCTG-TAMRA-3 '25 62.6 60.0
...