Home Cart Quotation About-Us
www.ChineseStandard.net
SEARCH

GB/T 27528-2011 English PDF

Q: How long will the true-PDF of English version of GB/T 27528-2011 be delivered?

Upon your order, we will start to translate GB/T 27528-2011_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Q: Can I share the purchased PDF of GB/T 27528-2011_English with my colleagues?

Yes. The purchased PDF of GB/T 27528-2011_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Q: Does the price include tax/VAT?

Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries). Avoidance of Double Taxation Agreements (DTAs) between Singapore and 100+ Countries: https://www.iras.gov.sg/taxes/international-tax

Q: Do you accept my currency other than USD?

Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.

US$209.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
GB/T 27528-2011: Real-time RT-PCR for detection of foot and mouth disease virus
Status: Valid

Standard ID	USD	BUY PDF	Lead-Days	Standard Title (Description)	Status
GB/T 27528-2011	209	Add to Cart	3 days	Real-time RT-PCR for detection of foot and mouth disease virus	Valid

Similar standards

GB/T 25165 NY/T 1663 GB/T 20365 GB/T 27530 GB/T 27533 GB/T 27532

Basic data

Standard ID: GB/T 27528-2011 (GB/T27528-2011)
Description (Translated English): Real-time RT-PCR for detection of foot and mouth disease virus
Sector / Industry: National Standard (Recommended)
Classification of Chinese Standard: B41
Classification of International Standard: 11.220
Word Count Estimation: 9,961
Date of Issue: 2011-11-21
Date of Implementation: 2012-03-01
Quoted Standard: GB/T 6682; GB/T 18088; GB/T 18935; GB 19489; SN/T 1193
Regulation (derived from): Announcement of Newly Approved National Standards No. 18 of 2011
Issuing agency(ies): General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, Standardization Administration of the People's Republic of China
Summary: This standard specifies the FMD virus real-time fluorescent RT-PCR detection methods. This standard applies to the detection and identification of FMD virus.

GB/T 27528-2011: Real-time RT-PCR for detection of foot and mouth disease virus

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Real-time RT-PCR for detection of foot and mouth disease virus ICS 11.220 B41 National Standards of People's Republic of China FMD virus real-time fluorescent RT-PCR detection method Issued on. 2011-11-21 2012-03-01 implementation Administration of Quality Supervision, Inspection and Quarantine of People's Republic of China Standardization Administration of China released

Foreword

This standard Annex A, Annex B normative appendix. The standard proposed by the People's Republic of China Ministry of Agriculture. This standard by the National Standardization Technical Committee Animal Epidemic Prevention (SAC/TC181) centralized. This standard was drafted. People's Republic of China SZCIQ, Chinese Academy of Inspection and Quarantine, Beijing surplus Jiusi Science and Technology Development Company Limited. The main drafters of this standard. Qinzhi Feng, Lin Xiangmei, Wu Shaojiang, flower Qun Yi, Lu Kang body, Liu, Chen Shukun, Lv Jianjiang, had less spirit, Zhanai Jun, Han Xueqing, Sun Jie, Caochen Fu, Jia Guang Yue, Gao Bo, Chen Bing, Ruanzhou Xi, Mei Lin, Zhang Caihong, TAO. FMD virus real-time fluorescent RT-PCR detection method

1 Scope

This standard specifies the FMD virus in real-time fluorescent RT-PCR detection method. This standard applies to the detection and identification of FMD virus.

2 Normative references

The following documents contain provisions which, through reference in this standard and become the standard terms. For dated references, subsequent Amendments (not including errata content) or revisions do not apply to this standard, however, encourage the parties to the agreement are based on research Whether the latest versions of these documents. For undated reference documents, the latest versions apply to this standard. Laboratory use specifications and test methods GB/T 6682 Analysis GB/T 18088 Entry and Exit Animal Quarantine sampling GB/T 18935 FMD diagnostic techniques GB 19489 General requirements for laboratory biosafety SN/T 1193 genetic testing laboratory technical requirements

3 Abbreviations

The following abbreviations apply to this standard. Ct values. cycle threshold (cyclethreshold).

4 Reagents and equipment supplies

4.1 Reagent Consumables 4.1.1 Unless otherwise indicated, the reagents used in the assay are analytically pure laboratory water should be consistent with GB/T 6682 requirements. 4.1.2 FMDV real-time fluorescent RT-PCR reagents. -20 ℃ to save, see Appendix A. 4.1.3 primer and probe sequences Upstream primer (FMDV-F) sequence. 5'ACTGGGTTTTACAAACCTGTGA3 '. Downstream primer (FMDV-R) sequence. 5'GCGAGTCCTGCCACGGA3 '. TaqMan probes (FMDV-Pb) sequence. 5'TCCTTTGCACGCCGTGGGAC3 ', 5' and 3 'ends are labeled FAM and BHQ. 4.1.4 DEPC-treated water. See Appendix B. Recommended for later commercialization of DEPC-treated DNA and RNA enzyme free water. 4.1.5 chloroform. AR, stored at room temperature. 4.1.6 isopropanol. AR, prior to use pre-cooled to -20 ℃. 4.1.7 75% ethanol. water and ethanol in DEPC formulated before use precooled to -20 ℃. 4.1.8 quartz sand. a commercially available chemically pure, after 121 ℃, 15min autoclave spare. 4.1.9 0.01mol/LPBS, pH7.6 ~ 7.8. See Appendix B. 4.1.10 positive control tissue culture inactivated vaccine virus or inactivated virus, -20 ℃ stored for use. Negative control samples may be healthy pigs Or bovine tissue material. 4.2 The main equipment 4.2.1 PCR fluorescence detector. 4.2.2 high-speed desktop refrigerated centrifuge. temperature controlled to 4 ℃, centrifuged at speeds of up to 12000g above. ......

Image

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of GB/T 27528-2011_English be delivered?

Answer: Upon your order, we will start to translate GB/T 27528-2011_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of GB/T 27528-2011_English with my colleagues?

Answer: Yes. The purchased PDF of GB/T 27528-2011_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.