Home Cart Quotation About-Us
www.ChineseStandard.net
SEARCH

GB/T 27644-2011 English PDF

Q: How long will the true-PDF of English version of GB/T 27644-2011 be delivered?

Upon your order, we will start to translate GB/T 27644-2011_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Q: Can I share the purchased PDF of GB/T 27644-2011_English with my colleagues?

Yes. The purchased PDF of GB/T 27644-2011_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Q: Does the price include tax/VAT?

Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries). Avoidance of Double Taxation Agreements (DTAs) between Singapore and 100+ Countries: https://www.iras.gov.sg/taxes/international-tax

Q: Do you accept my currency other than USD?

Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.

US$259.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
GB/T 27644-2011: Protocol of real-time PCR for detecting Gallid Hepers Virus 2
Status: Valid

Standard ID	USD	BUY PDF	Lead-Days	Standard Title (Description)	Status
GB/T 27644-2011	259	Add to Cart	3 days	Protocol of real-time PCR for detecting Gallid Hepers Virus 2	Valid

Similar standards

GB/T 25165 NY/T 1663 GB/T 20365 GB/T 27635 GB/T 27637 GB/T 27634

Basic data

Standard ID: GB/T 27644-2011 (GB/T27644-2011)
Description (Translated English): Protocol of real-time PCR for detecting Gallid Hepers Virus 2
Sector / Industry: National Standard (Recommended)
Classification of Chinese Standard: B41
Classification of International Standard: 11.220
Word Count Estimation: 11,112
Date of Issue: 2011-12-30
Date of Implementation: 2012-04-01
Quoted Standard: GB/T 6682
Regulation (derived from): Announcement of Newly Approved National Standards No. 22 of 2011
Issuing agency(ies): General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, Standardization Administration of the People's Republic of China
Summary: This standard specifies the avian herpes virus type 2 PCR detection method of operation. This standard applies to avian herpes simplex virus type 2 Identification and epidemiological investigation, diagnosis, quarantine and monitoring.

GB/T 27644-2011: Protocol of real-time PCR for detecting Gallid Hepers Virus 2

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Protocol of real-time PCR for detecting Gallid Hepers Virus 2 ICS 11.220 B41 National Standards of People's Republic of China Avian herpes simplex virus type 2 fluorescent PCR detection method Issued on. 2011-12-30 2012-04-01 implementation Administration of Quality Supervision, Inspection and Quarantine of People's Republic of China Standardization Administration of China released

Foreword

This standard was drafted in accordance with GB/T 1.1-2009 rules. The standard proposed by the People's Republic of China Ministry of Agriculture. This standard by the National Standardization Technical Committee Animal Epidemic Prevention (SAC/TC181) centralized. This standard was drafted. People's Republic of China SZCIQ, Yangzhou University, Henan Agricultural University. The main drafters of this standard. Zhanai Jun, Liu Wenbo, Wang Wei, Lu Kang body, flower Qun Yi, Chen Shukun, Qin Zhifeng, Bing, Gao Bo. Avian herpes simplex virus type 2 fluorescent PCR detection method

1 Scope

This standard specifies the method of operation avian herpes simplex virus type 2 fluorescent PCR detection. This standard applies to avian herpes simplex virus type 2 Identification and epidemiology, diagnosis, quarantine and monitoring.

2 Normative references

The following documents for the application of this document is essential. For dated references, only the dated version suitable for use herein Member. For undated references, the latest edition (including any amendments) applies to this document. Laboratory use specifications and test methods GB/T 6682 Analysis

3 Abbreviations

The following abbreviations apply to this document. The number of cycles the amount of fluorescence signal of each reaction tube reaches a set threshold when experienced. Ct value. DNA. deoxyribonucleicacid DNA. dNTP. deoxy-ribonucleosidetriphosphate deoxyribonucleoside triphosphates. Containing dCTP, dGTP, dATP, dTTP four kinds of deoxyribonucleoside. EDTA. ethylenediaminetetraaceticacid ethylenediaminetetraacetic acid. GHV2. GalidHepersVirus2 avian herpes simplex virus type 2 (Marek's disease virus serotype 1). MD. Marek'sDisease Marek's disease. PBS. phosphatebelancedsolution phosphate buffered saline. PCR. polymerasechainreaction polymerase chain reaction. Real-timePCR. Real-timepolymerasechainreaction real time polymerase chain reaction. Taq enzyme. Thermusaquaticuspolymerase thermostable DNA polymerase.

4 Reagents

4.1 Reagent Grade. Except as otherwise provided, the method should meet the two test water water GB/T 6682 provisions, the use of chemicals were divided Analytical grade. 4.2 Avian herpes simplex virus type 2 fluorescent PCR detection kit, -20 ℃ preservation, composition and precautions in Appendix A. 4.3 primer and probe sequences (product length 142bp) Upstream primer. 5'CCACCACCTCCCATCTGTAC3 ' Downstream primer. 5'GACAAGGCTGAGCGTAAACC3 ' TaqMan probes. 5'ACACGGCTCGGTAACAGGACACAATG3 ', 5' and 3 'ends are labeled FAM And BHQ (or Tamra or Eclipse). 4.4 1% heparin, preparation methods, see B.1,4 ℃ preservation. 4.5 chloroform, stored at room temperature. ......

Image

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of GB/T 27644-2011_English be delivered?

Answer: Upon your order, we will start to translate GB/T 27644-2011_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of GB/T 27644-2011_English with my colleagues?

Answer: Yes. The purchased PDF of GB/T 27644-2011_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.