GB/T 25876-2010 English PDF

US$169.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
GB/T 25876-2010: Method of nested PCR for sex identification of early cattle embryo
Status: Valid

Standard ID	USD	BUY PDF	Lead-Days	Standard Title (Description)	Status
GB/T 25876-2010	169	Add to Cart	3 days	Method of nested PCR for sex identification of early cattle embryo	Valid

Similar standards

GB/T 35823   GB/T 35892   GB/T 25165   GB/T 25879   GB/T 25881   GB/T 25875   

Basic data

Standard ID: GB/T 25876-2010 (GB/T25876-2010)
Description (Translated English): Method of nested PCR for sex identification of early cattle embryo
Sector / Industry: National Standard (Recommended)
Classification of Chinese Standard: B43
Classification of International Standard: 65.020.30
Word Count Estimation: 7,745
Date of Issue: 1/10/2011
Date of Implementation: 6/1/2011
Quoted Standard: GB/T 6682
Regulation (derived from): Announcement of Newly Approved National Standards 2011 No. (No. 166 overall) 1
Issuing agency(ies): General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, Standardization Administration of the People's Republic of China
Summary: This Standard specifies cattle early embryo sexing nested PCR methods. This Standard is applicable to sex identification of cows and beef cattle embryo or fetus.

GB/T 25876-2010: Method of nested PCR for sex identification of early cattle embryo

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Method of nested PCR for sex identification of early cattle embryo ICS 65.020.30 B43 National Standards of People's Republic of China Bovine early embryo gender identification nested PCR Issued on. 2011-01-10 2011-06-01 implementation Administration of Quality Supervision, Inspection and Quarantine of People's Republic of China Standardization Administration of China released

Foreword

Appendix B of this standard is a normative appendix, Appendix A is an information appendix. The standard proposed by the People's Republic of China Ministry of Agriculture. This standard by the National Standardization Technical Committee of animal husbandry. This standard was drafted. Huazhong Agricultural University. The main drafters of this standard. - selection of Yang Liguo, Li Xiang, Liu Hui, Liu move, Huxiu Zhong. Bovine early embryo gender identification nested PCR

1 Scope

This standard specifies the nested PCR sexing of bovine early embryos. This standard applies to dairy and beef sexing embryo or fetus.

2 Normative references

The following documents contain provisions which, through reference in this standard and become the standard terms. For dated references, subsequent Amendments (not including errata content) or revisions do not apply to this standard, however, encourage the parties to the agreement are based on research Whether the latest versions of these documents. For undated reference documents, the latest versions apply to this standard. Laboratory use specifications and test methods GB/T 6682 Analysis

3 Terms and Definitions

The following terms and definitions apply to this standard. 3.1 Nested PCR nestedpolymerasechainreaction The use of two sets of PCR primers (nested PCR primer pairs) two rounds of PCR amplification reaction, in the first round of amplification, the outer primer for production Health amplification products, the presence of this product, including primers, DNA as a template, a second round of amplification. 3.2 SRY gene SRYgene Male sex genes determine mammalian Y chromosome. 3.3 HBB gene HBBgene β-globin gene, located on chromosome often. Principle 4 The use of nested PCR reaction with high sensitivity and specificity of the characteristics of a small amount of SRY gene fragment was amplified embryonic cells to HBB gene was amplified as a positive reference, electrophoresis PCR products amplified product according to the electrophoretic bands embryo gender identification.

5 primer

SRY1 5'CTACTCCCCAACCGTCAGAAC3 ' 5'AGCCCAAACCCATCAACCTA3 ' SRY2 5'CCAGGGAACTGCTTGGGTA3 ' 5'TGCTTCTCCACTTAGGCTCAA3 ' HBB 5'TATCCCACTTACAAGGCAGGTT3 ' ......

Image     

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of GB/T 25876-2010_English be delivered?

Answer: Upon your order, we will start to translate GB/T 25876-2010_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of GB/T 25876-2010_English with my colleagues?

Answer: Yes. The purchased PDF of GB/T 25876-2010_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.