GB/T 25887-2010 English PDF

US$189.00 · In stock
Delivery: <= 3 days. True-PDF full-copy in English will be manually translated and delivered via email.
GB/T 25887-2010: Method of PCR-RFLP for detecting complex vertebral malformation in dairy cattle
Status: Valid

Standard ID	USD	BUY PDF	Lead-Days	Standard Title (Description)	Status
GB/T 25887-2010	189	Add to Cart	3 days	Method of PCR-RFLP for detecting complex vertebral malformation in dairy cattle	Valid

Similar standards

GB/T 35823   GB/T 35892   GB/T 25165   GB/T 25881   GB/T 25883   GB/T 25879   

Basic data

Standard ID: GB/T 25887-2010 (GB/T25887-2010)
Description (Translated English): Method of PCR-RFLP for detecting complex vertebral malformation in dairy cattle
Sector / Industry: National Standard (Recommended)
Classification of Chinese Standard: B43
Classification of International Standard: 65.020.30
Word Count Estimation: 8,848
Date of Issue: 1/10/2011
Date of Implementation: 6/1/2011
Quoted Standard: GB/T 6682
Regulation (derived from): Announcement of Newly Approved National Standards 2011 No. (No. 166 overall) 1
Issuing agency(ies): General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, Standardization Administration of the People's Republic of China
Summary: This Standard specifies the cow spinal deformity syndrome PCR-RFLP detection technology. This Standard is applicable to the detection and diagnosis of spinal deformity syndrome cows.

GB/T 25887-2010: Method of PCR-RFLP for detecting complex vertebral malformation in dairy cattle

---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order.
Method of PCR-RFLP for detecting complex vertebral malformation in dairy cattle ICS 65.020.30 B43 National Standards of People's Republic of China Cows vertebral malformation syndrome detection PCR-RFLP method Issued on. 2011-01-10 2011-06-01 implementation Administration of Quality Supervision, Inspection and Quarantine of People's Republic of China Standardization Administration of China released

Foreword

Appendix B of this standard is a normative appendix, Appendix A, Appendix C is informative appendix. The standard proposed by the People's Republic of China Ministry of Agriculture. This standard by the National Standardization Technical Committee of animal husbandry. This standard was drafted. Huazhong Agricultural University. The main drafters of this standard. - selection of Yang Liguo, Li Xiang, Huxiu Zhong, Liu Wenju, Song Lijun. Cows vertebral malformation syndrome detection PCR-RFLP method

1 Scope

This standard specifies the PCR-RFLP detection cows spinal deformity syndrome. This standard applies to the detection and diagnosis of spinal deformity Cow Syndrome.

2 Normative references

The following documents contain provisions which, through reference in this standard and become the standard terms. For dated references, subsequent Amendments (not including errata content) or revisions do not apply to this standard, however, encourage the parties to the agreement are based on research Whether the latest versions of these documents. For undated reference documents, the latest versions apply to this standard. Laboratory use specifications and test methods GB/T 6682 Analysis

3 Terms and Definitions

The following terms and definitions apply to this standard. 3.1 Cows spinal deformity syndrome complexvertebralmalformationindairycattle; CVM One kind of cow autosomal recessive genetic disease, mainly for cow abortion, early fetal death, died shortly after birth, sick calves The main symptoms. short neck, spine deformities, heart defects, leg deformities, Department of the Ministry presents symmetrical inward stiff like. 3.2 SLC35A3 gene SLC35A3gene Located on bovine chromosome 3 in the gene sequence databases (GenBank) the accession number AY160683, full-length 14901bp, mRNA is 981bp, composed of seven exons and six introns of the gene encoding ribosomal protein transport, and development related to the spine, cows Spinal deformity syndrome disease gene. 3.3 Restriction fragment length polymorphism restrictionfragmentlengthpolymorphism, RFLP The size of the detected DNA with the restriction enzyme digestion formed specific DNA segments. Therefore, any change can cause restriction sites Different mutations such as point mutations (new generation and removal of restriction sites) and reorganize some DNA (such as insertions and deletions cause between restriction sites The change in length) may also lead to the generation of RFLP. Principle 4 SLC35A3 gene exon 4 of the first 559 bp G to T, the corresponding encoded amino acid valine change Phenylalanine, resulting in the occurrence of spinal deformity syndrome cows. Using PCR-RFLP technique to detect bovine genomic DNA sample variation, namely SLC35A3 gene was amplified by PCR fragment, restriction endonuclease digestion of the PCR amplification products, electrophoresis digestion products of SLC35A3 gene were classified according to whether they carry the genotype determination cows vertebral malformation syndrome disease gene. 5 SLC35A3 gene amplified fragment introduced restriction site PCR primers 5'CCACTGGAAAAACATGCTGTGAGTA3 ' 5'GCTCTCCTCTGTAATCCCCA3 ' Expected amplification length is 225bp. ......

Image     

Tips & Frequently Asked Questions:

Question 1: How long will the true-PDF of GB/T 25887-2010_English be delivered?

Answer: Upon your order, we will start to translate GB/T 25887-2010_English as soon as possible, and keep you informed of the progress. The lead time is typically 1 ~ 3 working days. The lengthier the document the longer the lead time.

Question 2: Can I share the purchased PDF of GB/T 25887-2010_English with my colleagues?

Answer: Yes. The purchased PDF of GB/T 25887-2010_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.

Question 3: Does the price include tax/VAT?

Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countries

Question 4: Do you accept my currency other than USD?

Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay.