SN/T 1166.3-2006 English PDF
Basic dataStandard ID: SN/T 1166.3-2006 (SN/T1166.3-2006)Description (Translated English): Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus Sector / Industry: Commodity Inspection Standard (Recommended) Classification of Chinese Standard: B41 Classification of International Standard: 11.220 Word Count Estimation: 10,112 Date of Issue: 2006-01-26 Date of Implementation: 2006-08-16 Quoted Standard: GB/T 6682 Regulation (derived from): ?Industry Standard Announcement 2006 No.4 (Total No.76); National-Quality-Inspection-accreditation (2010) 582 Issuing agency(ies): General Administration of Customs Summary: This standard specifies the vesicular stomatitis virus type New Jersey (NJ) and Indiana -based (IND) for the qualitative RT-PCR detection methods and stereotypes. SN/T 1166.3-2006: Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus---This is a DRAFT version for illustration, not a final translation. Full copy of true-PDF in English version (including equations, symbols, images, flow-chart, tables, and figures etc.) will be manually/carefully translated upon your order. Protocol of reverse transcription polymerase chain reaction (RT-PCR) for vesicular stomatitis virus Book of the People's Republic of China Entry and Exit Inspection and Quarantine Blisters stomatitis reverse transcriptase polymerase chain reaction protocol Released on.2006-01-26 Implementation of.2006-08-16 People's Republic The General Administration of Quality Supervision, Inspection and Quarantine issued ForewordSN/T 1166 is divided into three parts. --- blister stomatitis complement binding test procedures; --- vesicular stomatitis micro serum neutralization test procedures; --- vesicular stomatitis reverse transcriptase polymerase chain reaction protocol. This part is the third part of SN/T 1166. Appendix A of this part is a normative appendix, and Appendix B is an informative appendix. This part is proposed and managed by the National Certification and Accreditation Administration. This section drafted by. Yunnan Entry-Exit Inspection and Quarantine Bureau of the People's Republic of China. The main drafters of this section. Hua Qunyi, Zhou Xiaoli, Xu Zizhong, Dong Jun, Yang Yunqing, Long Zhongbao. This section is the first industry standard for entry-exit inspection and quarantine. Blisters stomatitis reverse transcriptase polymerase chain reaction protocol1 ScopeThis part of SN/T 1166 specifies the RT-PCR characterization of the vesicular stomatitis virus New Jersey (NJ) and Indiana (IND). And stereotype detection methods. This section applies to the identification of vesicular stomatitis virus and epidemiological investigation, diagnosis, quarantine and monitoring of this disease.2 Normative referencesThe provisions in the following documents become the provisions of this part by reference to this part of SN/T 1166. Quotations with dated , all subsequent amendments (not including errata content) or revisions do not apply to this section, however, encouragement is achieved under this section The parties to the agreement study whether the latest versions of these documents can be used. For undated references, the latest edition applies to this section. GB/T 6682 Analytical laboratory water specifications and test methods3 reagents and materials3.1 Water Should meet the specifications of the first grade water in GB/T 6682. 3.2 Reagent purity All chemical reagents were of analytical grade. 3.3 vesicular stomatitis virus standard strain New Jersey-type (NJ) and Indiana-type (IND) standard strains, provided by designated units. 3.4 T犪狇 enzyme Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature. 3.5 reverse transcriptase AM犞 Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature. Store at -20 °C to avoid repeated freezing and thawing or drastic changes in temperature. Containing 10 mmol/L each of dCTP, dGTP, dATP, and dTTP. 3.8 Primers 3.8.1 In this test, the more conserved sequence of the vesicular stomatitis virus L protein gene was used as the PCR amplification region. Semi-sleeve RT-PCR In the method, the half-set primers were designed according to the base differences of the amplified regions of the NJ strain and the IND strain, respectively. Lateral primer I (P1). 5'AAGGCTCTCTGTTTCCGGATCTGG3' Outer Primer II (P2). 5'TGATTCAATATAATTATTTTGGGAC3' NJ half-set primer (P3). 5'TGTTCTGGTGTGCAAACCAGGTATC3' IND half set primer (P4). 5'AGTAGAACTGTGCAAGCCCGGTATC3' 3.8.2 The primers were formulated to a concentration of 25 pmol/μL with DEPC water. 3.9 isoamyl alcohol Pre-cool to -20 °C before use. ......Tips & Frequently Asked Questions:Question 1: How long will the true-PDF of SN/T 1166.3-2006_English be delivered?Answer: Upon your order, we will start to translate SN/T 1166.3-2006_English as soon as possible, and keep you informed of the progress. The lead time is typically in 9 seconds (download/delivered in 9 seconds). The lengthier the document the longer the lead time.Question 2: Can I share the purchased PDF of SN/T 1166.3-2006_English with my colleagues?Answer: Yes. The purchased PDF of SN/T 1166.3-2006_English will be deemed to be sold to your employer/organization who actually pays for it, including your colleagues and your employer's intranet.Question 3: Does the price include tax/VAT?Answer: Yes. Our tax invoice, downloaded/delivered in 9 seconds, includes all tax/VAT and complies with 100+ countries' tax regulations (tax exempted in 100+ countries) -- See Avoidance of Double Taxation Agreements (DTAs): List of DTAs signed between Singapore and 100+ countriesQuestion 4: Do you accept my currency other than USD?Answer: Yes. If you need your currency to be printed on the invoice, please write an email to Sales@ChineseStandard.net. In 2 working-hours, we will create a special link for you to pay in any currencies. Otherwise, follow the normal steps: Add to Cart -- Checkout -- Select your currency to pay. |
